AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i158_CYD_operon_ecoli_reg_100.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 cydD 122 ATP-binding component of cytochrome-related transport, Zn sensitive Motif number 1 ACAAAAGTAAAGAAGGCGACACCATGCGAC 1 26 1 AGAAGGCGAC 0.998796 -97 AGAAGGCGACACCATGCGACTATGGGTCGC 1 36 1 ACCATGCGAC 0.994332 -87 GGGGAAAAAATAAAGGCGACCCATAGTCGC 1 51 0 TAAAGGCGAC 0.991761 -72 TGCACGCTTAGCAGGTGAGTTATCAGAAT 1 104 0 AGCAGGTGAG 0.991738 -19 ********** Masking position 4 Map Score: 5.32015 Number of sites scoring better than the average of aligned sites = 454 Number in coding regions = 428 Number in noncoding regions = 26 Number of orfs with sites within 600 bp upstream = 27 Fraction of orfs with sites within 600 bp upstream = 0.00433665 Motif number 2 ********** No masking Map Score: 1.23224e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 3 ********** No masking Map Score: 1.23224e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 1.23224e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0