AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i160_Porphyrin_Biosynthesis_ecoli_reg_300.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 yjaD 94 orf, hypothetical protein #2 hemE 39 uroporphyrinogen decarboxylase Motif number 1 TCTCACTGAGCAGTTTTTGAATACAAACTT 1 23 0 CAGTTTTTGA 0.924806 -72 AAAAACTGCTCAGTGAGAAATGTAAAAACC 1 35 1 CAGTGAGAAA 0.969197 -60 TTAAACATGCCAGTGATGCAAAGGTAGTGC 1 68 1 CAGTGATGCA 0.985492 -27 GATGCAAAGGTAGTGCAAGAGCT 1 82 1 TAGTGCAAGA 0.966174 -13 GTCAGGCGGTCAGTGTATCA 2 1 0 CAGTGTATCA 0.991438 -39 GGCTGTTCCTTAGTGCGTCAGGCGGTCAGT 2 17 0 TAGTGCGTCA 0.989407 -23 ********** Masking position 4 Map Score: 5.59228 Number of sites scoring better than the average of aligned sites = 1305 Number in coding regions = 1203 Number in noncoding regions = 102 Number of orfs with sites within 600 bp upstream = 115 Fraction of orfs with sites within 600 bp upstream = 0.0184709 Motif number 2 ********** No masking Map Score: -6.15168e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 3 ********** No masking Map Score: -6.15168e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -6.15168e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0