AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i247_regulatory_cassete2_ecoli_reg_300.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 atoS 214 sensor protein AtoS for response regulator AtoC Motif number 1 CGAGGCTTTCAGGGTTGTACGAAAAGAAGCA 1 17 1 AGGGTTGTAG 0.86328 -198 GGTATTTCAAAGGGGCGAAGCTCCGCCTCAG 1 49 1 AGGGGCGAAC 0.936645 -166 AAGCTCCGCCTCAGGTGACCGATGGAGTGTG 1 66 1 TCAGGTGACG 0.921986 -149 ACCGATGGAGTGTGGTTAAGGTAGCGGTAAA 1 83 1 TGTGGTTAAG 0.938312 -132 TGGTTAAGGTAGCGGTAAAAGCGTGTTACCG 1 95 1 AGCGGTAAAG 0.991285 -120 GAGAGAACATTGCGGTAACACGCTTTTACCG 1 107 0 TGCGGTAACC 0.966275 -108 ATGATTTCTCGGCGGTGTATCATATTCCAGA 1 141 0 GGCGGTGTAC 0.966225 -74 GACGATTATCAGAGGTTAAGGTGATGATTTC 1 164 0 AGAGGTTAAG 0.964057 -51 ACTAGTCTTGTCCGGTATATGACGATTATCA 1 184 0 TCCGGTATAG 0.947844 -31 ********* * Masking position 4 Map Score: 5.82993 Number of sites scoring better than the average of aligned sites = 4387 Number in coding regions = 4113 Number in noncoding regions = 274 Number of orfs with sites within 600 bp upstream = 317 Fraction of orfs with sites within 600 bp upstream = 0.0509155 Motif number 2 GTAGCGCGAGGCTTTCAGGGTTGTACG 1 8 1 GAGGCTTTCA 0.995632 -207 AGGTTAAGGTGATGATTTCTCGGCGGTGTA 1 153 0 GATGATTTCT 0.982573 -62 GACAAGACTAGTGGATTTCAGC 1 203 1 GTGGATTTCA 0.993539 -12 ********** Masking position 6 Map Score: 1.89589 Number of sites scoring better than the average of aligned sites = 67 Number in coding regions = 59 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 3 ********** No masking Map Score: -1.32571e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.32571e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.32571e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0