AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i253_chemotaxis2_ecoli_reg_300.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 motA 126 proton conductor component of motor; no effect on switching #2 flhD 300 regulator of flagellar biosynthesis, acting on class 2 operons; transcriptional initiation factor Motif number 1 GCAACATTCCAGCAGCGGTAACGACGTACC 1 26 1 AGCAGCGGTA 0.996483 -101 GGCAAAAAAAAGCAGCGGTACGTCGTTACC 1 42 0 AGCAGCGGTA 0.996483 -85 AACGGAGGGGGGCTGCGATTTTCAATAATG 2 59 0 GGCTGCGATT 0.977471 -242 AGTTGCGATAAGCTGCAATAAGCAGAACCA 2 192 0 AGCTGCAATA 0.971575 -109 GCATTAGAATAGTTGCGATAAGCTGCAATA 2 202 0 AGTTGCGATA 0.976165 -99 GTCGCCGGGAAGCCCCGGTAAAAAATAATT 2 233 0 AGCCCCGGTA 0.979248 -68 CGACATCACGGGGTGCGGTGAAACCGCATA 2 259 1 GGGTGCGGTG 0.968643 -42 ********** Masking position 9 Map Score: 9.88875 Number of sites scoring better than the average of aligned sites = 937 Number in coding regions = 898 Number in noncoding regions = 39 Number of orfs with sites within 600 bp upstream = 41 Fraction of orfs with sites within 600 bp upstream = 0.00658529 Motif number 2 TAACGACGTACCGCTGCTTTTTTTTGCCCCAAT 1 44 1 CCGCTCTTTT 0.921745 -83 TACCCATTTATGTTAAGTAATTGA 2 2 1 ACCCATTTTT 0.98233 -299 TCCTAAATCGACGCAACTGTACTCGTCACTACA 2 98 0 ACGCACTTCT 0.990513 -203 AAGTGTAAAGACCCATTTCTATTTGTAAGGACA 2 143 1 ACCCATTTTT 0.982331 -158 CAATAAGCAGAACCACCTTTTTGGTTTAATATG 2 174 0 AACCACTTTG 0.944772 -127 TTGCAGCTTATCGCAACTATTCTAATGCTAATT 2 204 1 TCGCACTTCT 0.96263 -97 CCAGAATAACCAACTTTATTTTTATGCGGT 2 281 0 AACCACTTTT 0.98223 -20 ***** ** * ** Masking position 8 Map Score: 4.43418 Number of sites scoring better than the average of aligned sites = 322 Number in coding regions = 268 Number in noncoding regions = 54 Number of orfs with sites within 600 bp upstream = 54 Fraction of orfs with sites within 600 bp upstream = 0.00867331 Motif number 3 CTGATACGGTGAGGCGCAACATTCCA 1 7 1 CGGTGAGGCG 0.983298 -120 AACAGTGGAAGGATGATGTC 1 117 1 GGATGATGTC 0.882404 -10 TTTCAATAATGCGTGATGCAGATCACACAA 2 40 0 GCGTGATGCA 0.970538 -261 TACAACGGAGGGGGGCTGCGATTTTCAATA 2 62 0 GGGGGCTGCG 0.957866 -239 CGTTGTATGTGCGTGTAGTGACGAGTACAG 2 85 1 GCGTGTAGTG 0.89079 -216 CGTGATGTCGCCGGGAAGCCCCGGTAAAAA 2 239 0 CCGGGAAGCC 0.986799 -62 TCACCGCACCCCGTGATGTCGCCGGGAAGC 2 250 0 CCGTGATGTC 0.985336 -51 TCACGGGGTGCGGTGAAACCGCATAAAAAT 2 264 1 CGGTGAAACC 0.93601 -37 ********** Masking position 5 Map Score: 5.0293 Number of sites scoring better than the average of aligned sites = 3679 Number in coding regions = 3499 Number in noncoding regions = 180 Number of orfs with sites within 600 bp upstream = 169 Fraction of orfs with sites within 600 bp upstream = 0.0271442 Motif number 4 GACCATGACAGGATGTTCAGTCGTCAGGCG 1 87 0 GGATGTTCAG 0.986271 -40 AAACCAAAAAGGTGGTTCTGCTTATTGCAG 2 180 1 GGTGGTTCTG 0.994702 -121 AAATAAAGTTGGTTATTCTGG 2 290 1 GGTTATTCTG 0.987936 -11 ********** Masking position 6 Map Score: 0.597686 Number of sites scoring better than the average of aligned sites = 98 Number in coding regions = 96 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 5 ********** No masking Map Score: 6.34815e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 6.34815e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 6.34815e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0