AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i023_Formate_Dehydrogenase_hinf_reg_300.orf -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI0007 300 formate dehydrogenase, beta subunit (fdxH) Motif number 1 TCGCCTTTTTGGATGCCTTTTTCTGCCGCT 1 21 0 GGATGCCTTT 0.964724 -280 CGGTCGCCGTGGTTACAAAACGTCTTAAAG 1 89 1 GGTTACAAAA 0.832867 -212 CAGTGAATTGGAAGACCTATATGGTGTACG 1 141 0 GAAGACCTAT 0.951982 -160 ACTGGAATATGAAGGCATTAAATGGCAAAG 1 167 1 GAAGGCATTA 0.909858 -134 GAGAATCCACGGTTACCTTTGCCATTTAAT 1 183 0 GGTTACCTTT 0.941968 -118 GATTCTCTACGAATACCTTAACACCATCTT 1 206 1 GAATACCTTA 0.978159 -95 GTGTTTGCGTGATTGCCTCACCCCAAGATG 1 230 0 GATTGCCTCA 0.92378 -71 GCAAACACCAGAATACAAAACATTCTTGGT 1 252 1 GAATACAAAA 0.880636 -49 AAAAAGTTGGGGAGGCATAAT 1 290 1 GGAGGCATAA 0.968103 -11 ********** Masking position 6 Map Score: 9.06774 Number of sites scoring better than the average of aligned sites = 289 Number in coding regions = 247 Number in noncoding regions = 42 Number of orfs with sites within 600 bp upstream = 23 Fraction of orfs with sites within 600 bp upstream = 0.00369419 Motif number 2 AAAATTACTTCTCGTCGTGGCTATATTAAA 1 58 1 CTCGTCGTGG 0.984389 -243 TATTAAAGCGGTCGCCGTGGTTACAAAACG 1 81 1 GTCGCCGTGG 0.99697 -220 AATGGCAAAGGTAACCGTGGATTCTCTACG 1 187 1 GTAACCGTGG 0.958535 -114 TTAACACCATCTTGGGGTGAGGCAATCACG 1 223 1 CTTGGGGTGA 0.976182 -78 GTATTCTGGTGTTTGCGTGATTGCCTCACC 1 238 0 GTTTGCGTGA 0.966389 -63 TATTGAAAAAGTTGGGGAGGCATAAT 1 285 1 GTTGGGGAGG 0.982831 -16 ********** Masking position 2 Map Score: 4.83689 Number of sites scoring better than the average of aligned sites = 254 Number in coding regions = 237 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 3 GCGAAAAATTAGCGGCAGAA 1 1 1 GCGAAAAATT 0.98055 -300 AAGGCGATATGGTAAAAATTACTTCTCGTC 1 44 1 GGTAAAAATT 0.99102 -257 AAACATTCTTGGTAAATATTGAAAAAGTTG 1 269 1 GGTAAATATT 0.984252 -32 ********** Masking position 5 Map Score: 1.15638 Number of sites scoring better than the average of aligned sites = 113 Number in coding regions = 73 Number in noncoding regions = 40 Number of orfs with sites within 600 bp upstream = 30 Fraction of orfs with sites within 600 bp upstream = 0.0048185 Motif number 4 GCTTTAATATAGCCACGACGAGAAGTAATT 1 60 0 AGCCACGACG 0.988629 -241 GACGTTTTGTAACCACGGCGACCGCTTTAA 1 83 0 AACCACGGCG 0.957042 -218 TTCGTAGAGAATCCACGGTTACCTTTGCCA 1 189 0 ATCCACGGTT 0.918388 -112 ********** Masking position 5 Map Score: 0.98272 Number of sites scoring better than the average of aligned sites = 13 Number in coding regions = 11 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 5 TAAAGATCTCGAAATTGATGGGCGTGTCGT 1 114 1 GAAATTGATG 0.982345 -187 ATATTCCAGTGAATTGGAAGACCTATATGG 1 147 0 GAATTGGAAG 0.979077 -154 CAATTCACTGGAATATGAAGGCATTAAATG 1 161 1 GAATATGAAG 0.982354 -140 GGTAAATATTGAAAAAGTTGGGGAGGCATA 1 279 1 GAAAAAGTTG 0.925648 -22 ********** Masking position 3 Map Score: 0.582182 Number of sites scoring better than the average of aligned sites = 273 Number in coding regions = 252 Number in noncoding regions = 21 Number of orfs with sites within 600 bp upstream = 17 Fraction of orfs with sites within 600 bp upstream = 0.00273049 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0