AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i024_Formate_Dehydrogenase_hinf_reg_300.orf -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI0007 300 formate dehydrogenase, beta subunit (fdxH) #2 HI0009 69 fdhE protein (fdhE) Motif number 1 GCGAAAAATTAGCGGCAGAAAAAG 1 4 1 AAAAATTAGG 0.962605 -297 AAAGGCATCCAAAAAGGCGATATGGTAAAAA 1 31 1 AAAAAGGCGT 0.95516 -270 GCGATATGGTAAAAATTACTTCTCGTCGTGG 1 47 1 AAAAATTACT 0.803841 -254 TAAATATTGAAAAAGTTGGGGAGGCATAAT 1 281 1 AAAAGTTGGG 0.968931 -20 CTGAAAAAGAAAAAGTGCGGTTAAAATTGAC 2 20 1 AAAAGTGCGT 0.993055 -50 TTTTATAATAAAAAGTGCGGTCAATTTTAAC 2 39 0 AAAAGTGCGT 0.993055 -31 TTTTTATTATAAAAGTGAGAGAAT 2 56 1 AAAAGTGAGG 0.990975 -14 ********* * Masking position 4 Map Score: 7.73223 Number of sites scoring better than the average of aligned sites = 918 Number in coding regions = 592 Number in noncoding regions = 326 Number of orfs with sites within 600 bp upstream = 248 Fraction of orfs with sites within 600 bp upstream = 0.039833 Motif number 2 AGCGGCAGAAAAAGGCATCCAAAAAGGCGA 1 21 1 AAAGGCATCC 0.960729 -280 CTTTAAGACGTTTTGTAACCACGGCGACCG 1 89 0 TTTTGTAACC 0.797581 -212 CGTACACCATATAGGTCTTCCAATTCACTG 1 141 1 ATAGGTCTTC 0.940059 -160 CTTTGCCATTTAATGCCTTCATATTCCAGT 1 167 0 TAATGCCTTC 0.91034 -134 ATTAAATGGCAAAGGTAACCGTGGATTCTC 1 183 1 AAAGGTAACC 0.927748 -118 AAGATGGTGTTAAGGTATTCGTAGAGAATC 1 206 0 TAAGGTATTC 0.972772 -95 CATCTTGGGGTGAGGCAATCACGCAAACAC 1 230 1 TGAGGCAATC 0.90961 -71 ACCAAGAATGTTTTGTATTCTGGTGTTTGC 1 252 0 TTTTGTATTC 0.85367 -49 ATTATGCCTCCCCAACTTTTT 1 290 0 TTATGCCTCC 0.960697 -11 ********** Masking position 10 Map Score: 7.3316 Number of sites scoring better than the average of aligned sites = 289 Number in coding regions = 247 Number in noncoding regions = 42 Number of orfs with sites within 600 bp upstream = 23 Fraction of orfs with sites within 600 bp upstream = 0.00369419 Motif number 3 CATCCAAAAAGGCGATATGGTAAAAATTACTT 1 36 1 GGCGATAGTA 0.980594 -265 ATATAGCCACGACGAGAAGTAATTTTTACCAT 1 52 0 GACGAGAGAA 0.980451 -249 AGATCTTTAAGACGTTTTGTAACCACGGCGAC 1 91 0 GACGTTTGAA 0.969601 -210 GAAATTGATGGGCGTGTCGTACACCATATAGG 1 124 1 GGCGTGTGAC 0.981908 -177 ACCCCAAGATGGTGTTAAGGTATTCGTAGAGA 1 209 0 GGTGTTAGTA 0.947569 -92 ACACCATCTTGGGGTGAGGCAATCACGCAAAC 1 226 1 GGGGTGAGAA 0.987446 -75 ******* * ** Masking position 4 Map Score: 2.39282 Number of sites scoring better than the average of aligned sites = 192 Number in coding regions = 179 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 4 TTACCATATCGCCTTTTTGGATGCCTTTTT 1 29 0 GCCTTTTTGG 0.978425 -272 CGTGTCGTACACCATATAGGTCTTCCAATT 1 136 1 ACCATATAGG 0.966639 -165 ATACCTTAACACCATCTTGGGGTGAGGCAA 1 218 1 ACCATCTTGG 0.994735 -83 AGAATACAAAACATTCTTGGTAAATATTGA 1 261 1 ACATTCTTGG 0.981121 -40 ********** Masking position 5 Map Score: 2.1694 Number of sites scoring better than the average of aligned sites = 48 Number in coding regions = 46 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 5 GCGAAAAATTAGCGGCAGAAAAAGGCAT 1 9 1 TTAGCGGCAG 0.983417 -292 GCGGTCAATTTTAACCGCACTTTTTCTTTT 2 24 0 TTAACCGCAC 0.995915 -46 GCGGTTAAAATTGACCGCACTTTTTATTAT 2 36 1 TTGACCGCAC 0.994743 -34 ********** Masking position 9 Map Score: 0.623185 Number of sites scoring better than the average of aligned sites = 413 Number in coding regions = 260 Number in noncoding regions = 153 Number of orfs with sites within 600 bp upstream = 129 Fraction of orfs with sites within 600 bp upstream = 0.0207196 Motif number 6 ********** No masking Map Score: 1.65857e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 1.65857e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 1.65857e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0