AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i026_Fumarate_Reductase_hinf_reg_100.orf -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI0835 181 fumarate reductase, flavoprotein subunit (frdA) Motif number 1 AAAAAGCTAAGATTGAGTTGAGAGTAGCTC 1 20 0 GATTGAGTTG 0.986208 -162 CTCAATCTTAGCTTTTTTGAGGTAGATCAC 1 33 1 GCTTTTTTGA 0.861311 -149 AAAGTATCGGATTTTGTGATCTACCTCAA 1 49 0 GATTTTGTGA 0.960588 -133 TAAAANACGTTATTAATTTGTAACGAAAAA 1 92 1 TATTAATTTG 0.878287 -90 AAAAGGGTAATATTGTGTGGGCATTGTGCC 1 123 0 TATTGTGTGG 0.982116 -59 CCTTTTAGGGGATTTATTTTTACTTTCTAT 1 147 1 GATTTATTTT 0.878289 -35 TTTTACTTTCTATTGATTGGAGGATATC 1 164 1 TATTGATTGG 0.983393 -18 ********** Masking position 4 Map Score: 5.07511 Number of sites scoring better than the average of aligned sites = 1030 Number in coding regions = 852 Number in noncoding regions = 178 Number of orfs with sites within 600 bp upstream = 89 Fraction of orfs with sites within 600 bp upstream = 0.0142949 Motif number 2 AACTCAATCTTAGCTTTTTTGAGGTAGATC 1 31 1 TAGCTTTTTT 0.966812 -151 TCCGATACNTTTCCATCTTTAGACATAAAA 1 67 1 TTCCATCTTT 0.960863 -115 TACAAATTAATAACGTTTTTATGTCTAAA 1 84 0 TAACGTTTT 0.676899 -98 GTGGGCATTGTGCCATTTTTCGTTACAAAT 1 107 0 TGCCATTTTT 0.987768 -75 CACACAATATTACCCTTTTAGGGGATTTAT 1 134 1 TACCCTTTTA 0.972272 -48 ********** Masking position 6 Map Score: 2.08119 Number of sites scoring better than the average of aligned sites = 568 Number in coding regions = 470 Number in noncoding regions = 98 Number of orfs with sites within 600 bp upstream = 90 Fraction of orfs with sites within 600 bp upstream = 0.0144555 Motif number 3 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0