AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i026_Fumarate_Reductase_hinf_reg_300.orf -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI0835 181 fumarate reductase, flavoprotein subunit (frdA) Motif number 1 GAGCTACTCTCAACTCAATCTTAGCTTTTT 1 20 1 CAACTCAATC 0.986208 -162 GTGATCTACCTCAAAAAAGCTAAGATTGAG 1 33 0 TCAAAAAAGC 0.861311 -149 TTGAGGTAGATCACAAAATCCGATACNTTT 1 49 1 TCACAAAATC 0.960588 -133 TTTTTCGTTACAAATTAATAACGTTTTTA 1 92 0 CAAATTAATA 0.878287 -90 GGCACAATGCCCACACAATATTACCCTTTT 1 123 1 CCACACAATA 0.982116 -59 ATAGAAAGTAAAAATAAATCCCCTAAAAGG 1 147 0 AAAATAAATC 0.878289 -35 GATATCCTCCAATCAATAGAAAGTAAAA 1 164 0 CCAATCAATA 0.983393 -18 ********** Masking position 7 Map Score: 5.07511 Number of sites scoring better than the average of aligned sites = 1030 Number in coding regions = 852 Number in noncoding regions = 178 Number of orfs with sites within 600 bp upstream = 89 Fraction of orfs with sites within 600 bp upstream = 0.0142949 Motif number 2 GATCTACCTCAAAAAAGCTAAGATTGAGTT 1 31 0 AAAAAAGCTA 0.966429 -151 TTTTATGTCTAAAGATGGAAAGTATCGGA 1 67 0 AAAGATGGAA 0.960415 -115 TTTAGACATAAAANACGTTATTAATTTGTA 1 84 1 AAANACGTTA 0.966344 -98 ATTTGTAACGAAAAATGGCACAATGCCCAC 1 107 1 AAAAATGGCA 0.987624 -75 ATAAATCCCCTAAAAGGGTAATATTGTGTG 1 134 0 TAAAAGGGTA 0.971953 -48 ********** Masking position 5 Map Score: 2.08119 Number of sites scoring better than the average of aligned sites = 387 Number in coding regions = 331 Number in noncoding regions = 56 Number of orfs with sites within 600 bp upstream = 50 Fraction of orfs with sites within 600 bp upstream = 0.00803084 Motif number 3 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0