AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i036_Acetate_Metabolism_hinf_reg_100.orf -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI1203 67 phosphate acetyltransferase (pta) #2 HI1204 214 acetate kinase (ackA) Motif number 1 ACAACAAGCTGCCGAATTTTTCGGCAGTTTT 1 15 1 GCGAATTTTT 0.983838 -53 TTTTCGGCAGTTTTTATTTATAAAATATACA 1 32 1 TTTTATTTAT 0.742746 -36 TAAACCTTAATATGTATATTTTATAAATAAA 1 44 0 TTGTATATTT 0.88833 -24 TGATAAGTGCGGTCAATTTTTGAGGTGTTTT 2 12 0 GTCAATTTTT 0.974446 -203 CGCTATTTTAAGTCTATTTTTAGTAAAAATA 2 45 1 ATCTATTTTT 0.948179 -170 AGTAAAAATAGTTTAATTTTTCAAAAAATAC 2 66 1 GTTAATTTTT 0.960398 -149 TACAAACTTTATCGTATTTTTTGAAAAATTA 2 79 0 ACGTATTTTT 0.966897 -136 TACGATAAAGTTTGTATTTTTTCCTTACCGA 2 94 1 TTGTATTTTT 0.972606 -121 TTTCCTTACCGATGAATTTATTTTATTCATC 2 113 1 GTGAATTTAT 0.948346 -102 TGTATTCTATGTCTGATTTTTCAAACCATCT 2 150 1 GCTGATTTTT 0.942987 -65 CATCTTAGATGATGGATTTCTATTAACCTCA 2 176 1 GTGGATTTCT 0.927501 -39 AGGAACCCTATATTTGATTGAGGTT 2 200 0 ACCTATATTT 0.771301 -15 * ********* Masking position 6 Map Score: 16.011 Number of sites scoring better than the average of aligned sites = 1243 Number in coding regions = 969 Number in noncoding regions = 274 Number of orfs with sites within 600 bp upstream = 229 Fraction of orfs with sites within 600 bp upstream = 0.0367812 Motif number 2 TTTAACAACAAGCTGCCGAA 1 1 1 TTTAACAACA 0.942437 -67 ATTAAACTATTTTTACTAAAAATAGACTTA 2 53 0 TTTTACTAAA 0.813711 -162 AATAGTTTAATTTTTCAAAAAATACGATAA 2 72 1 TTTTTCAAAA 0.811078 -143 ATTTATTTTATTCATCAAAAGGTGTATTCT 2 128 1 TTCATCAAAA 0.957746 -87 CTATGTCTGATTTTTCAAACCATCTTAGAT 2 156 1 TTTTTCAAAC 0.958123 -59 ********** Masking position 8 Map Score: 3.66484 Number of sites scoring better than the average of aligned sites = 336 Number in coding regions = 261 Number in noncoding regions = 75 Number of orfs with sites within 600 bp upstream = 65 Fraction of orfs with sites within 600 bp upstream = 0.0104401 Motif number 3 GCAGTTTTTATTTATAAAATATACATATTAA 1 38 1 TTATAAAATA 0.954521 -30 ACTAAAAATAGACTTAAAATAGCGTATGATA 2 38 0 GCTTAAAATA 0.969488 -177 AAACTATTTTTACTAAAAATAGACTTAAAAT 2 49 0 TCTAAAAATA 0.953863 -166 AGTTTAATTTTTCAAAAAATACGATAAAGTT 2 75 1 TCAAAAAATA 0.979806 -140 CACCTTTTGATGAATAAAATAAATTCATCGG 2 121 0 TAATAAAATA 0.974119 -94 TGAAAAATCAGACATAGAATACACCTTTTGA 2 142 0 GCATAGAATA 0.958495 -73 TCTATTAACCTCAATCAAATATAGGGTTCCT 2 194 1 TAATCAAATA 0.920584 -21 * ********* Masking position 8 Map Score: 7.2997 Number of sites scoring better than the average of aligned sites = 339 Number in coding regions = 231 Number in noncoding regions = 108 Number of orfs with sites within 600 bp upstream = 106 Fraction of orfs with sites within 600 bp upstream = 0.0170254 Motif number 4 TTTAACAACAAGCTGCCGAATTTTTCGGC 1 10 1 AAGCTGCCGA 0.998126 -58 TTATAAATAAAAACTGCCGAAAAATTCGGC 1 25 0 AAACTGCCGA 0.997239 -43 ********** Masking position 5 Map Score: 1.11019 Number of sites scoring better than the average of aligned sites = 4 Number in coding regions = 3 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 5 TTTAACAACAAGCTGCCGAAT 1 2 1 TTAACAACAA 0.921647 -66 AGTTAAACCTTAATATGTATATT 1 55 0 TAAACCTTAA 0.962108 -13 AAAAACACCTCAAAAATTGACCG 2 4 1 AACACCTCAA 0.965032 -211 TGGATTTCTATTAACCTCAATCAAATATAG 2 188 1 TTAACCTCAA 0.984265 -27 ********** Masking position 4 Map Score: 0.869191 Number of sites scoring better than the average of aligned sites = 118 Number in coding regions = 102 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 18 Fraction of orfs with sites within 600 bp upstream = 0.0028911 Motif number 6 ********** No masking Map Score: -7.57276e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -7.57276e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -7.57276e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0