AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i096_Nitrogen_Transport_hinf_reg_300.orf -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI0329 37 conserved hypothetical protein #2 HI0330 98 opacity associated protein (oapA) #3 HI0331 59 opacity associated protein (oapB) #4 HI0334 77 GTP pyrophosphokinase (relA) #5 HI0336 82 molybdopeterin biosynthesis protein (mog) Motif number 1 GAAATATCCTAAAAATGAGAGATGGTTTGA 1 15 1 AAAAATGAGA 0.990869 -23 TGAGAAGCTCAAAAGTGCGGCGAAAAAATT 2 30 0 AAAAGTGCGG 0.994586 -69 AATTAGCCACAAAATTGAGAAGCTCAAAAG 2 45 0 AAAATTGAGA 0.963993 -54 GCTAATTAATATAAATAAGAACAAGCATCA 2 68 1 ATAAATAAGA 0.90086 -31 TCCACCCAAAATAAAAGCGACAGGAAGTTG 4 31 1 ATAAAAGCGA 0.91865 -47 CCCTCCAAAAGTGCGGTAAGTTTTTA 5 7 1 AAAAGTGCGG 0.994586 -76 TGGATAAATCAAAAATGCGGTAAAAACTTA 5 27 0 AAAAATGCGG 0.996351 -56 AATCATTTATAAAAATAAGGAAAAAT 5 67 1 AAAAATAAGG 0.975229 -16 ********** Masking position 4 Map Score: 16.7528 Number of sites scoring better than the average of aligned sites = 1024 Number in coding regions = 669 Number in noncoding regions = 355 Number of orfs with sites within 600 bp upstream = 266 Fraction of orfs with sites within 600 bp upstream = 0.0427241 Motif number 2 CATCTCTCATTTTTAGGATATTTCAAAT 1 8 0 TTTTAGGAAT 0.820188 -30 ATTATGTGTATTTTATCGGATC 2 2 0 TTTTATCGAT 0.937404 -97 TCGCCGCACTTTTGAGCTTCTCAATTTTGTG 2 37 1 TTTGAGCTCT 0.925772 -62 CTTCTCAATTTTGTGGCTAATTAATATAAAT 2 53 1 TTGTGGCTAT 0.945453 -46 TTTTTTGGGCGAGTAATCGCCCCT 3 4 1 TTTGGGCGGT 0.952853 -56 TGGGTGGATATTGTACCGAATAACCGAG 4 8 0 TTGTACCGAT 0.971042 -70 TCGCTTTTATTTTGGGTGGATATTGTACCGA 4 20 0 TTTGGGTGAT 0.906188 -58 TGCGGTAAGTTTTTACCGCATTTTTGATTTA 5 22 1 TTTTACCGAT 0.98734 -61 TATAAATGATTTTGACGTGATTGGATAAATC 5 47 0 TTTGACGTAT 0.92921 -36 ATTTTTCCTTATTTTTATAAAT 5 71 0 TTTTTCCTAT 0.891986 -12 ******** ** Masking position 2 Map Score: 7.08025 Number of sites scoring better than the average of aligned sites = 947 Number in coding regions = 818 Number in noncoding regions = 129 Number of orfs with sites within 600 bp upstream = 127 Fraction of orfs with sites within 600 bp upstream = 0.0203983 Motif number 3 TAATATAAATAAGAACAAGCATCAGAGGCA 2 74 1 AAGAACAAGC 0.990714 -25 AGAACTTAAAAAGAAAAAGGGGCGATTACT 3 22 0 AAGAAAAAGG 0.988903 -38 TATCCACCCAAAATAAAAGCGACAGGAAGT 4 29 1 AAATAAAAGC 0.862099 -49 CTTGTTGATGAAGAGCAAGCAACTTCCTGT 4 50 0 AAGAGCAAGC 0.970438 -28 CTTGCTCTTCATCAACAAGGGGGTATT 4 61 1 ATCAACAAGG 0.976663 -17 GATTGGATAAATCAAAAATGCGGTAAAAAC 5 30 0 ATCAAAAATG 0.775394 -53 AATCATTTATAAAAATAAGGAAAAAT 5 67 1 AAAAATAAGG 0.939953 -16 ********** Masking position 7 Map Score: 5.44428 Number of sites scoring better than the average of aligned sites = 727 Number in coding regions = 619 Number in noncoding regions = 108 Number of orfs with sites within 600 bp upstream = 96 Fraction of orfs with sites within 600 bp upstream = 0.0154192 Motif number 4 TTGGGCGAGTAATCGCCCCTTTTTCTTTTT 3 15 1 AATCGCCCCT 0.983112 -45 AAATCCTACCTTGAGAAAAGA 3 49 0 AATCCTACCT 0.970891 -11 TTCGGTACAATATCCACCCAAAATAAAAGC 4 19 1 TATCCACCCA 0.984743 -59 AATACCCCCTTGTTGATGAA 4 68 0 AATACCCCCT 0.975173 -10 ATTTTTGATTTATCCAATCACGTCAAAATC 5 41 1 TATCCAATCA 0.845897 -42 ********** Masking position 3 Map Score: 1.42612 Number of sites scoring better than the average of aligned sites = 156 Number in coding regions = 125 Number in noncoding regions = 31 Number of orfs with sites within 600 bp upstream = 22 Fraction of orfs with sites within 600 bp upstream = 0.00353357 Motif number 5 ********** No masking Map Score: -5.58897e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -5.58897e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -5.58897e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0