AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i118_SecDF_hinf_reg_100.orf -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI0240 69 protein-export membrane protein (secD) #2 HI0241 107 conserved hypothetical protein Motif number 1 AATGCGTGGCTCTGGAAAATAATTTAATGT 1 16 0 TCTGGAAAAT 0.941752 -54 TTAGAAAAGAAAAGGAAAACT 1 59 1 AAAGGAAAAC 0.980953 -11 TATCCTACGTTATGGCGATTAATT 2 5 0 TATGGCGATT 0.911668 -103 AAAGGCGAACTAAGCCCAATATCCTACGTT 2 24 0 TAAGCCCAAT 0.957434 -84 CTTCATTGGGAAAGGCGAACTAAGCCCAAT 2 34 0 AAAGGCGAAC 0.980957 -74 TATGGTATTTTACGCAAAATTTTTAACTTA 2 69 1 TACGCAAAAT 0.949074 -39 CTTAAATTAATAAGGAAAACACA 2 95 1 TAAGGAAAAC 0.991624 -13 ********** Masking position 8 Map Score: 5.66101 Number of sites scoring better than the average of aligned sites = 798 Number in coding regions = 649 Number in noncoding regions = 149 Number of orfs with sites within 600 bp upstream = 131 Fraction of orfs with sites within 600 bp upstream = 0.0210408 Motif number 2 GAATAACATTAAATTATTTTCCAGA 1 6 1 ACATTAAATT 0.936863 -64 TGCGTAAAATACCATAAATTGCTTCATTGG 2 55 0 ACCATAAATT 0.986155 -53 CAAAATTTTTAACTTAAATTAATAAGGAAA 2 83 1 AACTTAAATT 0.718655 -25 ********** Masking position 6 Map Score: 2.62838 Number of sites scoring better than the average of aligned sites = 28 Number in coding regions = 17 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 3 AATTATTTTCCAGAGCCACGCATTGTGGCT 1 22 1 CAGAGCCACG 0.997102 -48 TTCTAACGCACAGAGCCACAATGCGTGGCT 1 35 0 CAGAGCCACA 0.998742 -35 ********** Masking position 4 Map Score: 2.56658 Number of sites scoring better than the average of aligned sites = 1 Number in coding regions = 0 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 4 GTGGCTCTGTGCGTTAGAAAAGAAAAGGAA 1 46 1 GCGTTAGAAA 0.990619 -24 AATCGCCATAACGTAGGATATTGGGCTTAG 2 15 1 ACGTAGGATA 0.975637 -93 TAAAAATTTTGCGTAAAATACCATAAATTG 2 64 0 GCGTAAAATA 0.98556 -44 TTATTAATTTAAGTTAAAAATTTTGCGTAA 2 78 0 AAGTTAAAAA 0.91734 -30 ********** Masking position 4 Map Score: 1.25282 Number of sites scoring better than the average of aligned sites = 253 Number in coding regions = 216 Number in noncoding regions = 37 Number of orfs with sites within 600 bp upstream = 31 Fraction of orfs with sites within 600 bp upstream = 0.00497912 Motif number 5 ********** No masking Map Score: -1.11255e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.11255e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.11255e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0