AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i175_biotin_biosynthesis1_hinf_reg_100.orf -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI1022 112 biotin synthetase (bioB) #2 HI1556 59 2-hydroxyacid dehydrogenase #3 HI1560 22 H. influenzae predicted coding region HI1560 #4 HI1561 106 peptide chain release factor 1 (prfA) Motif number 1 GAAAGTATAAAAAGCGTGGTGTTTTTAACC 1 74 1 AAAGCGTGGT 0.995066 -39 TTTTCCTTTGAAAGTGCGGTTAAAAACACC 1 91 0 AAAGTGCGGT 0.998909 -22 ATTTCATCAAAAGTGCGGTTAATTTTGAC 2 10 1 AAAGTGCGGT 0.998909 -50 TTTTATATACAAAGTGCGGTCAAAATTAAC 2 28 0 AAAGTGCGGT 0.998909 -32 ********** Masking position 3 Map Score: 13.9262 Number of sites scoring better than the average of aligned sites = 1115 Number in coding regions = 700 Number in noncoding regions = 415 Number of orfs with sites within 600 bp upstream = 285 Fraction of orfs with sites within 600 bp upstream = 0.0457758 Motif number 2 TCCTTTGAAAGTGCGGTTAAAAACACCACG 1 88 0 GTGCGGTTAA 0.998284 -25 TTCATCAAAAGTGCGGTTAATTTTGACCGC 2 13 1 GTGCGGTTAA 0.998284 -47 TATATACAAAGTGCGGTCAAAATTAACCGC 2 25 0 GTGCGGTCAA 0.99875 -35 AATTTCCTTTTCGCTGTCAATTTTCCCTAA 4 45 1 TCGCTGTCAA 0.970931 -62 ********** Masking position 7 Map Score: 8.56352 Number of sites scoring better than the average of aligned sites = 394 Number in coding regions = 245 Number in noncoding regions = 149 Number of orfs with sites within 600 bp upstream = 122 Fraction of orfs with sites within 600 bp upstream = 0.0195952 Motif number 3 AAAACACCACGCTTTTTATACTTTCTTAAT 1 69 0 GCTTTTTATA 0.915102 -44 TAAAAAGCGTGGTGTTTTTAACCGCACTTT 1 81 1 GGTGTTTTTA 0.967371 -32 TAATTGCTCCTTTTTTATATACAAAGT 2 43 0 TCCTTTTTTA 0.958702 -17 GATAGGGACATCTGATTTCAG 3 12 1 TCTGATTTCA 0.941064 -11 GCGTATTCTAGCCGATTTTAGGGAAAATTG 4 62 0 GCCGATTTTA 0.995106 -45 GCTAGAATACGCCGATTTTATTTTCGGTGA 4 80 1 GCCGATTTTA 0.995106 -27 ********** Masking position 6 Map Score: 6.48804 Number of sites scoring better than the average of aligned sites = 422 Number in coding regions = 363 Number in noncoding regions = 59 Number of orfs with sites within 600 bp upstream = 45 Fraction of orfs with sites within 600 bp upstream = 0.00722775 Motif number 4 CGTTGAATTGATTGTTTCTACCATATACAC 1 29 1 ATTGTTTCTA 0.896232 -84 GTTTTTCCTTTGAAAGTGCG 1 103 0 GTTTTTCCTT 0.967143 -10 TAATTGCTCCTTTTTTATATAC 2 48 0 ATTGCTCCTT 0.953287 -12 CTGAAATCAGATGTCCCTATCA 3 4 0 GATGTCCCTA 0.975002 -19 TGAGATTCTTAATTTCCTTTTCGCTGTCAA 4 35 1 AATTTCCTTT 0.822341 -72 TTCGCTGTCAATTTTCCCTAAAATCGGCTA 4 54 1 ATTTTCCCTA 0.982403 -53 ********** Masking position 3 Map Score: 2.49882 Number of sites scoring better than the average of aligned sites = 418 Number in coding regions = 307 Number in noncoding regions = 111 Number of orfs with sites within 600 bp upstream = 123 Fraction of orfs with sites within 600 bp upstream = 0.0197559 Motif number 5 AGAAACAATCAATTCAACGTTATGAATGAA 1 18 0 AATTCAACGT 0.876393 -95 CATATACACTAATTCATCAATTAAGAAAGT 1 50 1 AATTCATCAA 0.969652 -63 AGTGCGGTTAAAAACACCACGCTTTTTATA 1 79 0 AAAACACCAC 0.92621 -34 ATTTCATCAAAAGTGCGGTT 2 1 1 ATTTCATCAA 0.851319 -59 GTGCGGTCAAAATTAACCGCACTTTTGATG 2 15 0 AATTAACCGC 0.933156 -45 TGGGTAAATCACAAATAAAGCGTCT 4 6 1 AAATCACAAA 0.850521 -101 AATCGGCTAGAATACGCCGATTTTATTTTC 4 75 1 AATACGCCGA 0.947545 -32 TTGTAAGTCACCGAAAATAAAATC 4 93 0 AAGTCACCGA 0.985492 -14 ********** Masking position 1 Map Score: 4.44938 Number of sites scoring better than the average of aligned sites = 1162 Number in coding regions = 985 Number in noncoding regions = 177 Number of orfs with sites within 600 bp upstream = 121 Fraction of orfs with sites within 600 bp upstream = 0.0194346 Motif number 6 ATTCAACGTTATGAATGAAACTAATT 1 7 0 ATGAATGAAA 0.968904 -106 ATTAGTGTATATGGTAGAAACAATCAATTC 1 33 0 ATGGTAGAAA 0.954548 -80 TACTTTCTTAATTGATGAATTAGTGTATAT 1 51 0 ATTGATGAAT 0.895536 -62 TAACCGCACTTTTGATGAAAT 2 2 0 TTTGATGAAA 0.895536 -58 ********** Masking position 8 Map Score: 0.432989 Number of sites scoring better than the average of aligned sites = 406 Number in coding regions = 362 Number in noncoding regions = 44 Number of orfs with sites within 600 bp upstream = 41 Fraction of orfs with sites within 600 bp upstream = 0.00658529 Motif number 7 ********** No masking Map Score: -7.57276e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -7.57276e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -7.57276e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0