AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i192_topoisomerase_hinf_reg_100.orf -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI1527 84 lipid A biosynthesis lauroyl acyltransferase (htrB) #2 HI1528 73 topoisomerase IV, subunit B (parE) #3 HI1529 66 topoisomerase IV, subunit A (parC) Motif number 1 TGGTTATTCAAATAGAGAGATTTTAAA 1 7 0 AATAGAGAAT 0.893877 -78 TCTCTATTTGAATAACCAAAATTGTGGCGAT 1 20 1 AATAACCAAA 0.97905 -65 GTTGTGGTAAAATCGCCACAATTTTGGTTAT 1 31 0 AATCGCCAAA 0.964128 -54 CACAACTCAAATTTACGATAAACTACGCCCC 1 56 1 ATTTACGAAA 0.98406 -29 AATTTTTTAAATTTGAGAAAATTCTATCAAA 2 37 0 ATTTGAGAAA 0.973806 -37 AATTTAAAAAATTAACGAATAACCTCACC 2 55 1 ATTAACGATA 0.945526 -19 AATTTTAATAAATTAAGAATATATCAATTAA 3 35 1 AATTAAGATA 0.958066 -32 AGAATATATCAATTAACAGAAACAAAA 3 50 1 AATTAACAAA 0.974598 -17 ******** ** Masking position 8 Map Score: 8.04431 Number of sites scoring better than the average of aligned sites = 667 Number in coding regions = 550 Number in noncoding regions = 117 Number of orfs with sites within 600 bp upstream = 99 Fraction of orfs with sites within 600 bp upstream = 0.0159011 Motif number 2 TTTAAAATCTCTCTATTTGAATAACCAAAA 1 11 1 CTCTATTTGA 0.964772 -74 GTAAAATCGCCACAATTTTGGTTATTCAAA 1 26 0 CACAATTTTG 0.920632 -59 TTTACCACAACTCAAATTTACGATAAACTA 1 51 1 CTCAAATTTA 0.992894 -34 TAAACTACGCCCCTAACTTAC 1 74 1 CCCTAACTTA 0.967291 -11 ATAGAATTTTCTCAAATTTAAAAAATTAAC 2 41 1 CTCAAATTTA 0.992894 -33 CTCAGCAAATCCGAATTTTAATAAATTAAG 3 22 1 CCGAATTTTA 0.971513 -45 ********** Masking position 5 Map Score: 6.71484 Number of sites scoring better than the average of aligned sites = 281 Number in coding regions = 238 Number in noncoding regions = 43 Number of orfs with sites within 600 bp upstream = 45 Fraction of orfs with sites within 600 bp upstream = 0.00722775 Motif number 3 AGGTTATTCGTTAATTTTTTAAATTTGAGA 2 50 0 TTAATTTTTT 0.978627 -24 TTTGCTGAGATTAATTTAGT 3 1 0 TTAATTTAGT 0.985506 -66 TGATATATTCTTAATTTATTAAAATTCGGA 3 31 0 TTAATTTATT 0.991445 -36 TTTGTTTCTGTTAATTGATATATTCTTAAT 3 46 0 TTAATTGATA 0.964175 -21 ********** Masking position 5 Map Score: 4.45311 Number of sites scoring better than the average of aligned sites = 83 Number in coding regions = 61 Number in noncoding regions = 22 Number of orfs with sites within 600 bp upstream = 23 Fraction of orfs with sites within 600 bp upstream = 0.00369419 Motif number 4 ATTCAAATAGAGAGATTTTAAA 1 3 0 AGAGATTTTA 0.92192 -82 CCAAAATTGTGGCGATTTTACCACAACTCA 1 35 1 GGCGATTTTA 0.989168 -50 CAAAAAGTGCGGTGATATTCGACCGCACTT 2 11 0 GGTGATATTC 0.985922 -63 GGTGAGGTTATTCGTTAATT 2 64 0 GGTGAGGTTA 0.992971 -10 ATTCGGATTTGCTGAGATTAATTTAGT 3 8 0 GCTGAGATTA 0.97948 -59 ********** Masking position 5 Map Score: 3.77466 Number of sites scoring better than the average of aligned sites = 182 Number in coding regions = 157 Number in noncoding regions = 25 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 5 GAATAACCAAAATTGTGGCGATTTTACCAC 1 29 1 AATTGTGGCG 0.978548 -56 GTAAGTTAGGGGCGTAGTTTAT 1 73 0 AAGTTAGGGG 0.978548 -12 AAGTGCGGTCGAATATCACC 2 1 1 AAGTGCGGTC 0.995441 -73 TTCTATCAAAAAGTGCGGTGATATTCGACC 2 17 0 AAGTGCGGTG 0.99828 -57 ********** Masking position 4 Map Score: 3.51522 Number of sites scoring better than the average of aligned sites = 821 Number in coding regions = 596 Number in noncoding regions = 225 Number of orfs with sites within 600 bp upstream = 184 Fraction of orfs with sites within 600 bp upstream = 0.0295535 Motif number 6 ********** No masking Map Score: -2.46258e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -2.46258e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -2.46258e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0