AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i263_hypothetical_hinf_reg_100.orf -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI0033 53 conserved hypothetical protein #2 HI0034 124 conserved hypothetical protein Motif number 1 GTTATTTTTTACCGCACTTTACTAAAAT 1 9 0 ACCGCACTTT 0.99875 -45 GTAAAAAATAACCGCACTTTTTAGATAAGG 1 27 1 ACCGCACTTT 0.99875 -27 CGCGAAATTAACCGCGCTTTTTATGTCTAA 2 27 0 ACCGCGCTTT 0.995775 -98 CGCGGTTAATTTCGCGCTTATTTTTTGCGT 2 41 1 TTCGCGCTTA 0.990796 -84 ATGATAGAATTCCGCACCTTTATTGCTAAG 2 95 1 TCCGCACCTT 0.996778 -30 TTTGTTCTCACTTAGCAATAAAGG 2 111 0 TTCTCACTTA 0.960089 -14 ********** Masking position 9 Map Score: 17.7562 Number of sites scoring better than the average of aligned sites = 1773 Number in coding regions = 1231 Number in noncoding regions = 542 Number of orfs with sites within 600 bp upstream = 335 Fraction of orfs with sites within 600 bp upstream = 0.0538066 Motif number 2 CGGTTATTTTTTACCGCACTTTACTAAAAT 1 11 0 TTACCGCACT 0.996039 -43 CGGTAAAAAATAACCGCACTTTTTAGATAA 1 25 1 TAACCGCACT 0.996039 -29 AGCGCGAAATTAACCGCGCTTTTTATGTCT 2 29 0 TAACCGCGCT 0.99749 -96 AGCGCGGTTAATTTCGCGCTTATTTTTTGC 2 39 1 ATTTCGCGCT 0.983934 -86 TCTTGCGCAAAATCCACGCAAAAAATAAGC 2 56 0 AATCCACGCA 0.949245 -69 CAATGATAGAATTCCGCACCTTTATTGCTA 2 93 1 ATTCCGCACC 0.991225 -32 ********** Masking position 5 Map Score: 12.1017 Number of sites scoring better than the average of aligned sites = 684 Number in coding regions = 419 Number in noncoding regions = 265 Number of orfs with sites within 600 bp upstream = 183 Fraction of orfs with sites within 600 bp upstream = 0.0293929 Motif number 3 ********** No masking Map Score: -1.75204e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.75204e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.75204e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0