AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i332_not_clear7_hinf_reg_100.orf -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI0588 99 N-carbamyl-L-amino acid amidohydrolase Motif number 1 AATTTTTCGTTGAAAATTAACCTTTTCTAA 1 32 0 TGAAAATTAA 0.957997 -68 TAATTTTCAACGAAAAATTATAATTGTTTG 1 43 1 CGAAAAATTA 0.995772 -57 TGATATTCGTCAAACAATTATAATTTTTCG 1 53 0 CAAACAATTA 0.988583 -47 TGACGAATATCAAAAAATAAACCGTATCAG 1 71 1 CAAAAAATAA 0.993514 -29 ********** Masking position 6 Map Score: 5.50641 Number of sites scoring better than the average of aligned sites = 210 Number in coding regions = 158 Number in noncoding regions = 52 Number of orfs with sites within 600 bp upstream = 48 Fraction of orfs with sites within 600 bp upstream = 0.0077096 Motif number 2 TTTCTAAGCGTAATATTGGTATTGCTAA 1 9 0 TAATATTGGT 0.99231 -91 AACGAAAAATTATAATTGTTTGACGAATAT 1 51 1 TATAATTGTT 0.928131 -49 GTTTATTTTTTGATATTCGTCAAACAATTA 1 63 0 TGATATTCGT 0.986767 -37 AGTTTTCTCCTGATACGGTTTATTTTTTGA 1 80 0 TGATACGGTT 0.978008 -20 ********** Masking position 5 Map Score: 1.16362 Number of sites scoring better than the average of aligned sites = 425 Number in coding regions = 374 Number in noncoding regions = 51 Number of orfs with sites within 600 bp upstream = 41 Fraction of orfs with sites within 600 bp upstream = 0.00658529 Motif number 3 ********** No masking Map Score: 1.66429e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 1.66429e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.66429e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0