AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i034_Pyruvate_Synthase_2_hpyl_reg_300.orf -o034_hpyl_300.ace -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -g0.39 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.39 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RHP00509 259 AE000511 Motif number 1 AAACTTTGTTATTATTTAAGGTGTGATTTGAT 1 32 0 ATTTTAAGGT 0.836315 -228 ACCACTAATATTTATTTTAAACTTTGTTATTA 1 50 0 TTTTTTAAAC 0.93792 -210 ATATTAGTGGTTTTTATTAAGAACGCTTGTCT 1 71 1 TTTTATAAGA 0.897541 -189 TTTATGGCCATTTATTCTAAAAAGACAAGCGT 1 93 0 TTTTTTAAAA 0.96378 -167 AATAGCCATAATTCTTGTAGGTATGCCCCCAT 1 124 1 ATTTTTAGGT 0.973204 -136 CTTTTTAGGAATTTTTATAGGAAAATGGGGGC 1 148 0 ATTTTTAGGA 0.989764 -112 TTATAACAATATCTTTTTAGGAATTTTTATAG 1 160 0 ATCTTTAGGA 0.953841 -100 CTAAAAAGATATTGTTATAAGACACATTAATA 1 172 1 ATTTTTAAGA 0.984227 -88 ATTAATAGTTTTTCTTGTATAATTCTAGGCTG 1 197 1 TTTTTTATAA 0.934663 -63 CTGAATTCAATTTATTTTATACGATATTAAGG 1 226 1 TTTTTTATAC 0.890123 -34 *** ** ***** Masking position 5 Map Score: 12.0977 Number of sites scoring better than the average of aligned sites = 497 Number in coding regions = 417 Number in noncoding regions = 80 Number of orfs with sites within 600 bp upstream = 73 Fraction of orfs with sites within 600 bp upstream = 0.011725 Motif number 2 ATGGCTATTTTATGGCCATTTATTCTAAAAA 1 102 0 TATGCCATTT 0.991583 -158 CTACAAGAATTATGGCTATTTTATGGCCATT 1 113 0 TATGCTATTT 0.98705 -147 TTCTTGTAGGTATGCCCCCATTTTCCTATAA 1 135 1 TATGCCCCAT 0.991133 -125 GGTAATATGTCTCCTTAATATCGTAT 1 244 0 TATGCTCCTT 0.994519 -16 **** ****** Masking position 3 Map Score: 3.30348 Number of sites scoring better than the average of aligned sites = 18 Number in coding regions = 15 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 3 TTGTTATTATTTAAGGTGTGATTTGATTTT 1 29 0 TTAAGGTGTG 0.992367 -231 AGAAAAACTATTAATGTGTCTTATAACAAT 1 182 0 TTAATGTGTC 0.988729 -78 TTATACGATATTAAGGAGACATATTACC 1 242 1 TTAAGGAGAC 0.987172 -18 ********** Masking position 4 Map Score: 0.841349 Number of sites scoring better than the average of aligned sites = 16 Number in coding regions = 15 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 4 ********** No masking Map Score: -3.81261e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -3.81261e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -3.81261e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0