AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i103_Ferrous_Iron_Transporter_hpyl_reg_100.orf -o103_hpyl_100.ace -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -g0.39 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.39 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RHP00118 143 AE000511 Motif number 1 CAAGAATGTTAAAAAATGAAAGGAGCGTGT 1 12 0 AAAAAATGAA 0.917253 -132 TGTTATATAATAAAAGCGAGACAAGAATGT 1 33 0 TAAAAGCGAG 0.993834 -111 TTTTATTATATAACAATTAGTCTTATAGCG 1 48 1 TAACAATTAG 0.974395 -96 GTTTTTAGATTAAAAGTCAGCACTATAGCG 1 76 0 TAAAAGTCAG 0.986399 -68 ACTTTTAATCTAAAAACGATATAACTAAAA 1 89 1 TAAAAACGAT 0.973859 -55 ACGATATAACTAAAAATTAGAAAAACTTTA 1 104 1 TAAAAATTAG 0.990474 -40 ********** Masking position 5 Map Score: 8.24676 Number of sites scoring better than the average of aligned sites = 456 Number in coding regions = 374 Number in noncoding regions = 82 Number of orfs with sites within 600 bp upstream = 69 Fraction of orfs with sites within 600 bp upstream = 0.0110826 Motif number 2 TATATAACAATTAGTCTTATAGCGCTATAGTG 1 54 1 TTAGTTATAG 0.992356 -90 AGATTAAAAGTCAGCACTATAGCGCTATAAGA 1 68 0 TCAGCTATAG 0.995468 -76 TATATCGTTTTTAGATTAAAAGTCAGCACTAT 1 80 0 TTAGAAAAAG 0.940547 -64 TTTCTAATTTTTAGTTATATCGTTTTTAGATT 1 95 0 TTAGTTATCG 0.983403 -49 GTTTGAATGCTCCGCATTAAAGTTTTTCTAAT 1 119 0 TCCGCTAAAG 0.985732 -25 ***** ***** Masking position 9 Map Score: 3.07077 Number of sites scoring better than the average of aligned sites = 109 Number in coding regions = 95 Number in noncoding regions = 14 Number of orfs with sites within 600 bp upstream = 11 Fraction of orfs with sites within 600 bp upstream = 0.00176678 Motif number 3 ********** No masking Map Score: -2.17836e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -2.17836e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.17836e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0