AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i126_Biopolymer_Transport_hpyl_reg_300.orf -o126_hpyl_300.ace -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -g0.39 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.39 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RHP00530 52 AE000511 #2 RHP00533 22 AE000511 #3 RHP00535 20 AE000511 #4 RHP00538 110 AE000511 #5 RHP00542 23 AE000511 #6 RHP00543 39 AE000511 #7 RHP00544 243 AE000511 Motif number 1 TAAGATATTTATAAAATCCCCTTAAAAGCT 1 6 0 ATAAAACTAA 0.987486 -47 CTATCTTAACAAAAAATCGCTTAAAATTTGAGAAT 4 20 0 AAAAAACAAA 0.946696 -91 CGCATTTGTTATAAAAACATTAACTCTATCTTAAC 4 45 0 ATAAAACACT 0.927225 -66 TATTTCTTTCCTAAAATCCTACAAAATATTTGAAA 4 82 0 CTAAAACAAA 0.969689 -29 TTGAATTAAAAACAAGGAATAAC 5 6 1 TTAAAACAAT 0.93812 -18 TACATTATAAATAAAAAAAATGAAGAAATTGAGAT 7 66 0 ATAAAAAAAG 0.887783 -178 TACCCTTCGCATAAAAACTACATTATAAATAAAAA 7 84 0 ATAAAACTTA 0.951788 -160 ACAACAAAAAATAAAAAAGGCAAAAAATACCCTTC 7 111 0 ATAAAAAAAA 0.971318 -133 GGGATTTTAAATACAAACAACAAAAAATAAAAAAG 7 127 0 ATACAACAAA 0.963417 -117 TTGTTTGTATTTAAAATCCCTATTTTACTGAACTT 7 142 1 TTAAAACTTT 0.661054 -102 AACTTATTGGATAAAACCTGCTTAAGTTAAATTGA 7 172 1 ATAAAACTAA 0.987486 -72 TCATTCTATTATAAAATATAAAAAATCAAATCTTA 7 209 1 ATAAAAAAAA 0.971318 -35 ****** * *** Masking position 6 Map Score: 12.9888 Number of sites scoring better than the average of aligned sites = 1458 Number in coding regions = 1226 Number in noncoding regions = 232 Number of orfs with sites within 600 bp upstream = 206 Fraction of orfs with sites within 600 bp upstream = 0.0330871 Motif number 2 AGCTTTTAAGGGGATTTTATAAATATCT 1 6 1 TTAAGGGATT 0.895529 -47 AACTCCCTATTTAAGATATTTATAAAATCCCCT 1 19 0 TTAAGATTAT 0.939228 -34 CGATTTTTTGTTAAGATAGAGTTAATGTTTTTA 4 36 1 TTAAGATGTT 0.954211 -75 GTGGTGTGCTTTGAGATGATATTGTGAATTAGG 6 16 1 TTGAGATATT 0.985678 -24 AAGCACAAGTTTTAGAGAACCATACG 7 4 0 TTTAGAGAAT 0.859445 -240 AATGAAGAAATTGAGATAACGATCGATCAGCTG 7 50 0 TTGAGATAAT 0.977222 -194 TTATAATAGAATGAGATCAATTTAACTTAAGCA 7 190 0 ATGAGATATT 0.925003 -54 GATTTTCCTTTAAGATTTGATTTTTTATATTT 7 222 0 TTAAGATTTT 0.961231 -22 ******* * ** Masking position 4 Map Score: 4.52843 Number of sites scoring better than the average of aligned sites = 186 Number in coding regions = 140 Number in noncoding regions = 46 Number of orfs with sites within 600 bp upstream = 52 Fraction of orfs with sites within 600 bp upstream = 0.00835207 Motif number 3 CTCTATCTTAACAAAAAATCGCTTAAAATT 4 27 0 ACAAAAAATC 0.95584 -84 CTAAAATCCTACAAAATATTTGAAACTCGC 4 77 0 ACAAAATATT 0.821903 -34 AGGATTTTAGGAAAGAAATAGGTT 4 97 1 GAAAGAAATA 0.820947 -14 TGAATTAAAAACAAGGAATAAC 5 12 1 ACAAGGAATA 0.889303 -12 CATTATAAATAAAAAAAATGAAGAAATTGA 7 69 0 AAAAAAAATG 0.855169 -175 TACCCTTCGCATAAAAACTACATTATAAAT 7 89 0 ATAAAAACTA 0.817635 -155 AATAAAAAAGGCAAAAAATACCCTTCGCAT 7 107 0 GCAAAAAATA 0.971739 -137 AATACAAACAACAAAAAATAAAAAAGGCAA 7 123 0 ACAAAAAATA 0.985983 -121 TCATTCTATTATAAAATATAAAAAATCAAA 7 209 1 ATAAAATATA 0.858437 -35 ********** Masking position 4 Map Score: 6.39667 Number of sites scoring better than the average of aligned sites = 552 Number in coding regions = 450 Number in noncoding regions = 102 Number of orfs with sites within 600 bp upstream = 89 Fraction of orfs with sites within 600 bp upstream = 0.0142949 Motif number 4 ********** No masking Map Score: 1.09013e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.09013e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.09013e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0