AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i129_Transmembrane_Transport_3_hpyl_reg_100.orf -o129_hpyl_100.ace -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -g0.39 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.39 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RHP01395 225 AE000511 #2 RHP01396 21 AE000511 Motif number 1 CTTAGGGTGTAACTTTAATTCAACAAGAAGGAT 1 16 0 ACTTTAACAA 0.971729 -210 AAAAAATTAAAACTTTTAGAAAAATAACCGATC 1 48 0 ACTTTTAAAA 0.992728 -178 AAAAGTTTTAATTTTTTATCAAAGATGAAGATT 1 64 1 ATTTTTAAAA 0.985102 -162 CCCACTTATTAGTATTTAACCAACATTTTCACT 1 101 0 ATATTTACAA 0.972122 -125 AACCGCCTCAAACTTTTAAAATACAAATTTTTA 1 150 1 ACTTTTAATA 0.982752 -76 TTAAAATACAAATTTTTAAGATACAAATAGGTA 1 165 1 ATTTTTAATA 0.96593 -61 ACCAATTCCAATCATTTAATCAAAGGGAGTTCT 1 203 1 ACATTTACAA 0.986237 -23 * ****** *** Masking position 8 Map Score: 10.4012 Number of sites scoring better than the average of aligned sites = 426 Number in coding regions = 328 Number in noncoding regions = 98 Number of orfs with sites within 600 bp upstream = 84 Fraction of orfs with sites within 600 bp upstream = 0.0134918 Motif number 2 ACTTTAATTCAACAAGAAGGATTTATT 1 4 0 AAAGAGATTT 0.933029 -222 ATCTTTGATAAAAAATTAAAACTTTTAGAAAAAT 1 56 0 AAATTAACTT 0.867745 -170 ATTTTTTATCAAAGATGAAGATTTTAGAGTGAAA 1 74 1 AAATGAATTT 0.87615 -152 GGTGTATCCCACTTATTAGTATTTAACCAACATT 1 107 0 ACATTGATTT 0.986149 -119 TTTGTATCTTAAAAATTTGTATTTTAAAAGTTTG 1 158 0 AAATTGATTT 0.970235 -68 TGGTGATTATACCTATTTGTATCTTAAAAATTTG 1 173 0 ACATTGATCT 0.974287 -53 CCTTTGATTAAATGATTGGAATTGGTGATTATAC 1 195 0 AAATTGATTG 0.982607 -31 ** *** * **** Masking position 5 Map Score: 4.57276 Number of sites scoring better than the average of aligned sites = 219 Number in coding regions = 178 Number in noncoding regions = 41 Number of orfs with sites within 600 bp upstream = 38 Fraction of orfs with sites within 600 bp upstream = 0.00610344 Motif number 3 ATTAAAGTTACACCCTAAGATCGGTTATTT 1 30 1 CACCCTAAGA 0.992302 -196 CCAACATTTTCACTCTAAAATCTTCATCTT 1 85 0 CACTCTAAAA 0.982242 -141 AAGTGGGATACACCCACAAAACAAACCGCC 1 127 1 CACCCACAAA 0.992622 -99 ACAAAACAAACCGCCTCAAACTTTTAAAAT 1 142 1 CCGCCTCAAA 0.986735 -84 ********** Masking position 8 Map Score: 3.13676 Number of sites scoring better than the average of aligned sites = 281 Number in coding regions = 261 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 21 Fraction of orfs with sites within 600 bp upstream = 0.00337295 Motif number 4 ACCCTAAGATCGGTTATTTTTCTAAAAGTT 1 41 1 CGGTTATTTT 0.975121 -185 AAGTTTGAGGCGGTTTGTTTTGTGGGTGTA 1 135 0 CGGTTTGTTT 0.993514 -91 AGAACTCCCTTTGATTAAATGATTGG 1 210 0 CCCTTTGATT 0.957657 -16 TGCTCGCCTTTTTTATGCGTT 2 8 0 CGCCTTTTTT 0.983077 -14 ********** Masking position 5 Map Score: 1.24451 Number of sites scoring better than the average of aligned sites = 365 Number in coding regions = 344 Number in noncoding regions = 21 Number of orfs with sites within 600 bp upstream = 17 Fraction of orfs with sites within 600 bp upstream = 0.00273049 Motif number 5 ********** No masking Map Score: -4.09683e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -4.09683e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -4.09683e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0