AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i129_Transmembrane_Transport_3_hpyl_reg_300.orf -o129_hpyl_300.ace -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -g0.39 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.39 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RHP01395 225 AE000511 #2 RHP01396 21 AE000511 Motif number 1 ATCCTTCTTGTTGAATTAAAGTTACACCCTAAG 1 16 1 TTGTTAAAGT 0.971729 -210 GATCGGTTATTTTTCTAAAAGTTTTAATTTTTT 1 48 1 TTTTAAAAGT 0.992728 -178 AATCTTCATCTTTGATAAAAAATTAAAACTTTT 1 64 0 TTTTAAAAAT 0.985102 -162 AGTGAAAATGTTGGTTAAATACTAATAAGTGGG 1 101 1 TTGTAAATAT 0.972122 -125 TAAAAATTTGTATTTTAAAAGTTTGAGGCGGTT 1 150 0 TATTAAAAGT 0.982752 -76 TACCTATTTGTATCTTAAAAATTTGTATTTTAA 1 165 0 TATTAAAAAT 0.96593 -61 AGAACTCCCTTTGATTAAATGATTGGAATTGGT 1 203 0 TTGTAAATGT 0.986237 -23 *** ****** * Masking position 8 Map Score: 10.4012 Number of sites scoring better than the average of aligned sites = 426 Number in coding regions = 328 Number in noncoding regions = 98 Number of orfs with sites within 600 bp upstream = 84 Fraction of orfs with sites within 600 bp upstream = 0.0134918 Motif number 2 ATTAAAGTTACACCCTAAGATCGGTTATTT 1 30 1 CACCCTAAGA 0.992604 -196 CCAACATTTTCACTCTAAAATCTTCATCTT 1 85 0 CACTCTAAAA 0.982932 -141 AAGTGGGATACACCCACAAAACAAACCGCC 1 127 1 CACCCACAAA 0.992912 -99 ACAAAACAAACCGCCTCAAACTTTTAAAAT 1 142 1 CCGCCTCAAA 0.987252 -84 ********** Masking position 8 Map Score: 3.13676 Number of sites scoring better than the average of aligned sites = 281 Number in coding regions = 261 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 21 Fraction of orfs with sites within 600 bp upstream = 0.00337295 Motif number 3 TAACCGATCTTAGGGTGTAACTTTAATTCAAC 1 25 0 TAGGTGAACT 0.979754 -201 TCTTTGATAAAAAATTAAAACTTTTAGAAAAA 1 57 0 AAAATAAACT 0.926755 -169 ATTTTTTATCAAAGATGAAGATTTTAGAGTGA 1 74 1 AAAGTGAGAT 0.932424 -152 ATGAAGATTTTAGAGTGAAAATGTTGGTTAAA 1 88 1 TAGATGAAAT 0.973768 -138 CTCAAACTTTTAAAATACAAATTTTTAAGATA 1 156 1 TAAATAAAAT 0.966074 -70 TACAAATTTTTAAGATACAAATAGGTATAATC 1 171 1 TAAGTAAAAT 0.978155 -55 **** ** **** Masking position 6 Map Score: 2.63856 Number of sites scoring better than the average of aligned sites = 106 Number in coding regions = 86 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 17 Fraction of orfs with sites within 600 bp upstream = 0.00273049 Motif number 4 AATAAATCCTTCTTGTTGAATTAAAGT 1 7 1 TCCTTCTTTT 0.95574 -219 CACCCTAAGATCGGTTATTTTTCTAAAAGTT 1 40 1 TCGGTTATTT 0.946025 -186 TGTGGGTGTATCCCACTTATTAGTATTTAAC 1 114 0 TCCCACTTTT 0.963067 -112 AAAGTTTGAGGCGGTTTGTTTTGTGGGTGTA 1 135 0 GCGGTTTGTT 0.955627 -91 AGAACTCCCTTTGATTAAATGATTGG 1 210 0 TCCCTTTGTT 0.988478 -16 TGCTCGCCTTTTTTATGCGTT 2 8 0 TCGCCTTTTT 0.979 -14 ******** ** Masking position 10 Map Score: 1.33555 Number of sites scoring better than the average of aligned sites = 469 Number in coding regions = 426 Number in noncoding regions = 43 Number of orfs with sites within 600 bp upstream = 42 Fraction of orfs with sites within 600 bp upstream = 0.0067459 Motif number 5 ********** No masking Map Score: -4.09683e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -4.09683e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -4.09683e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0