AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i164_NIF1_hpyl_reg_100.orf -o164_hpyl_100.ace -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -g0.39 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.39 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RHP01169 173 AE000511 #2 RHP01170 21 AE000511 Motif number 1 GAACACCCCCCTATCAAAAACCAACAACAG 1 26 0 CTATCAAAAA 0.933322 -148 GTGTTCGCATTTCTCAAAATGTTTTCAAAA 1 50 1 TTCTCAAAAT 0.975771 -124 TCTCAAAATGTTTTCAAAAATTCATCTTAT 1 61 1 TTTTCAAAAA 0.936913 -113 TTTCTTAATTTTAACTTAAAATAAGATGAA 1 81 0 TTAACTTAAA 0.889412 -93 ATACAAGATATTTTCTTAATTTTAACTTAA 1 92 0 TTTTCTTAAT 0.940388 -82 ATCTTGTATTTAATCATAATTTAGACTTAG 1 113 1 TAATCATAAT 0.876281 -61 ATAGATTTTCTTATCTAAGTCTAAATTATG 1 127 0 TTATCTAAGT 0.925832 -47 CCTCAAAAATTTTACATAGATTTTCTTATC 1 142 0 TTTACATAGA 0.849729 -32 GTTAATATTCTCCTCAAAAATTTTACATAG 1 153 0 TCCTCAAAAA 0.92892 -21 ********** Masking position 8 Map Score: 8.6418 Number of sites scoring better than the average of aligned sites = 2067 Number in coding regions = 1774 Number in noncoding regions = 293 Number of orfs with sites within 600 bp upstream = 219 Fraction of orfs with sites within 600 bp upstream = 0.0351751 Motif number 2 TGTTTTCAAAAATTCATCTTATTTTAAGTT 1 69 1 AATTCATCTT 0.865804 -105 TATTTTCTTAATTTTAACTTAAAATAAGAT 1 84 0 ATTTTAACTT 0.957455 -90 TAAATACAAGATATTTTCTTAATTTTAACT 1 95 0 ATATTTTCTT 0.924358 -79 AATATCTTGTATTTAATCATAATTTAGACT 1 110 1 ATTTAATCAT 0.940924 -64 TTTAATCATAATTTAGACTTAGATAAGAAA 1 121 1 ATTTAGACTT 0.882388 -53 TTTTACATAGATTTTCTTATCTAAGTCTAA 1 133 0 ATTTTCTTAT 0.816874 -41 TCTCCTCAAAAATTTTACATAGATTTTCTT 1 145 0 AATTTTACAT 0.841229 -29 GGTTAATATTCTCCTCAAAAATTTT 1 159 0 ATATTCTCCT 0.895829 -15 ********** Masking position 1 Map Score: 2.92593 Number of sites scoring better than the average of aligned sites = 1596 Number in coding regions = 1373 Number in noncoding regions = 223 Number of orfs with sites within 600 bp upstream = 195 Fraction of orfs with sites within 600 bp upstream = 0.0313203 Motif number 3 GCGACTTGGTAGCGGCTGTTGTTGG 1 6 1 TTGGTAGCGG 0.996931 -168 TTGTTGGTTTTTGATAGGGGGGTGTTCGCA 1 29 1 TTGATAGGGG 0.996622 -145 ********** Masking position 5 Map Score: 0.111329 Number of sites scoring better than the average of aligned sites = 12 Number in coding regions = 11 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 4 ********** No masking Map Score: 2.37484e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 2.37484e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.37484e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0