AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i198_enolase_hpyl_reg_100.orf -o198_hpyl_100.ace -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -g0.39 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.39 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RHP01107 98 AE000511 Motif number 1 ACCCTATCACAAAAGGATTTTACT 1 5 0 AAAAGGATTT 0.953103 -94 CTATTATAATAAAAGGACTTACCCTATCAC 1 25 0 AAAAGGACTT 0.984941 -74 CTTTTATTATAATAGATTTTAGGCTAGGAT 1 40 1 AATAGATTTT 0.912928 -59 TAGATTTTAGGCTAGGATTTGATAGAATAA 1 52 1 GCTAGGATTT 0.986314 -47 TACCTTATTGAATTTGATTTGTTTATTCTA 1 74 0 AATTTGATTT 0.912928 -25 ********** Masking position 9 Map Score: 5.908 Number of sites scoring better than the average of aligned sites = 994 Number in coding regions = 846 Number in noncoding regions = 148 Number of orfs with sites within 600 bp upstream = 127 Fraction of orfs with sites within 600 bp upstream = 0.0203983 Motif number 2 GACTTACCCTATCACAAAAGGATTTTACT 1 9 0 ATCAAAAAGG 0.996968 -90 AAAATCTATTATAATAAAAGGACTTACCCTA 1 29 0 ATAAAAAAGG 0.995513 -70 AACAAATCAAATTCAATAAGGTAATTTA 1 81 1 ATTCATAAGG 0.990629 -18 **** ****** Masking position 6 Map Score: 1.75521 Number of sites scoring better than the average of aligned sites = 105 Number in coding regions = 83 Number in noncoding regions = 22 Number of orfs with sites within 600 bp upstream = 25 Fraction of orfs with sites within 600 bp upstream = 0.00401542 Motif number 3 TAAAAGGACTTACCCTATCACAAAAGGATT 1 16 0 TACCCTATCA 0.995017 -83 TAAGTCCTTTTATTATAATAGATTTTAGGC 1 34 1 TATTATAATA 0.491197 -65 TATCAAATCCTAGCCTAAAATCTATTATAA 1 46 0 TAGCCTAAAA 0.965219 -53 TTGATTTGTTTATTCTATCAAATCCTAGCC 1 61 0 TATTCTATCA 0.980003 -38 TAAATTACCTTATTGAATTTGATTT 1 84 0 TACCTTATTG 0.936305 -15 ********** Masking position 6 Map Score: 1.88819 Number of sites scoring better than the average of aligned sites = 408 Number in coding regions = 338 Number in noncoding regions = 70 Number of orfs with sites within 600 bp upstream = 66 Fraction of orfs with sites within 600 bp upstream = 0.0106007 Motif number 4 ********** No masking Map Score: -1.89414e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.89414e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.89414e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0