AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i198_enolase_hpyl_reg_300.orf -o198_hpyl_300.ace -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -g0.39 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.39 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RHP01107 98 AE000511 Motif number 1 AGTAAAATCCTTTTGTGATAGGGT 1 5 1 AAATCCTTTT 0.956246 -94 GTGATAGGGTAAGTCCTTTTATTATAATAG 1 25 1 AAGTCCTTTT 0.984632 -74 ATCCTAGCCTAAAATCTATTATAATAAAAG 1 40 0 AAAATCTATT 0.91218 -59 TTATTCTATCAAATCCTAGCCTAAAATCTA 1 52 0 AAATCCTAGC 0.984998 -47 TAGAATAAACAAATCAAATTCAATAAGGTA 1 74 1 AAATCAAATT 0.91218 -25 ********** Masking position 2 Map Score: 5.908 Number of sites scoring better than the average of aligned sites = 994 Number in coding regions = 846 Number in noncoding regions = 148 Number of orfs with sites within 600 bp upstream = 127 Fraction of orfs with sites within 600 bp upstream = 0.0203983 Motif number 2 AGTAAAATCCTTTTGTGATAGGGTAAGTC 1 9 1 CCTTTTGTAT 0.997103 -90 TAGGGTAAGTCCTTTTATTATAATAGATTTT 1 29 1 CCTTTTATAT 0.995712 -70 TAAATTACCTTATTGAATTTGATTTGTT 1 81 0 CCTTATTGAT 0.991042 -18 ******** ** Masking position 10 Map Score: 1.75521 Number of sites scoring better than the average of aligned sites = 108 Number in coding regions = 90 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 3 CTTACCCTATCACAAAAGGATTTTACT 1 8 0 CACAAAAGGA 0.995833 -91 AATCTATTATAATAAAAGGACTTACCCTAT 1 28 0 AATAAAAGGA 0.990527 -71 TGATAGAATAAACAAATCAAATTCAATAAG 1 71 1 AACAAATCAA 0.96989 -28 ********** Masking position 5 Map Score: 0.8604 Number of sites scoring better than the average of aligned sites = 99 Number in coding regions = 87 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 4 ********** No masking Map Score: -1.89414e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.89414e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.89414e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0