AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i220_Ribosomal_Operon_7_hpyl_reg_300.orf -o220_hpyl_300.ace -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -g0.39 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.39 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RHP01312 55 AE000511 #2 RHP00471 290 AE000511 Motif number 1 TTTATTTTTTATTAATCGTTTTATTTTAGC 1 19 0 ATTAATCGTT 0.987705 -37 TTAATAAAAAATAAATCGTTAGAAAGAAGT 1 34 1 ATAAATCGTT 0.984677 -22 GAGTGCGATAAAGGGTCATTGGATGGTTTG 2 41 0 AAGGGTCATT 0.766492 -250 TGTTTGCTATGATAATCGTTTAAAAGTAAT 2 84 0 GATAATCGTT 0.94047 -207 TGGAGCGTTCAATGAGCGTTCTTATTTGTA 2 127 0 AATGAGCGTT 0.947937 -164 CATTGGCTAAATGGAGCGTTCAATGAGCGT 2 138 0 ATGGAGCGTT 0.979202 -153 CTTGACCGACAATAATCATTGGCTAAATGG 2 154 0 AATAATCATT 0.786171 -137 CCTTATAATAATAAATCGTTCCAAATAATA 2 205 0 ATAAATCGTT 0.984677 -86 ATTTATTATTATAAGGCGTTAGAGACGCTT 2 219 1 ATAAGGCGTT 0.96301 -72 ********** Masking position 9 Map Score: 14.107 Number of sites scoring better than the average of aligned sites = 775 Number in coding regions = 660 Number in noncoding regions = 115 Number of orfs with sites within 600 bp upstream = 100 Fraction of orfs with sites within 600 bp upstream = 0.0160617 Motif number 2 AAACGATTAATAAAAAATAAATCGTTAGAA 1 28 1 TAAAAAATAA 0.877527 -28 AAATAAATCGTTAGAAAGAAGTTA 1 42 1 TTAGAAAGAA 0.917726 -14 GACAAGGATTTTACAAGTAA 2 1 0 TTACAAGTAA 0.942492 -290 TGATAATCGTTTAAAAGTAATAAAATAACT 2 75 0 TTAAAAGTAA 0.964687 -216 CTGAATTTTTTTACAAATAAGAACGCTCAT 2 116 1 TTACAAATAA 0.974595 -175 CATGTTTTGATTAAAATTACCTTGACCGAC 2 174 0 TTAAAATTAC 0.871563 -117 TAATAAATCGTTCCAAATAATAGCATGTTT 2 197 0 TTCCAAATAA 0.906115 -94 CTTTGGCTGTTTAAAAAGAGCCTAATTTAA 2 246 1 TTAAAAAGAG 0.967644 -45 TAAGATTGCATTTAAATTAGGCTCTTTTTA 2 257 0 TTTAAATTAG 0.742324 -34 AAATGCAATCTTAAAAGGAGAAGCACT 2 274 1 TTAAAAGGAG 0.966906 -17 ********** Masking position 5 Map Score: 11.9106 Number of sites scoring better than the average of aligned sites = 516 Number in coding regions = 360 Number in noncoding regions = 156 Number of orfs with sites within 600 bp upstream = 139 Fraction of orfs with sites within 600 bp upstream = 0.0223257 Motif number 3 ATTAATCGTTTTATTTTAGCATGCACCA 1 5 0 TTATTTACAC 0.964126 -51 TGTCTTTCTTTTTTCAAACCATCCAATGACCCTT 2 27 1 TTTTAAACAC 0.98155 -264 CGTTTAAAAGTAATAAAATAACTCTTTGAGTGCG 2 64 0 TAATAAAAAC 0.944055 -227 TTTTAAACGATTATCATAGCAAACAAACTGAATT 2 89 1 TTATATACAC 0.977299 -202 GCGTTCTTATTTGTAAAAAAATTCAGTTTGTTTG 2 108 0 TTGTAAAAAC 0.924213 -183 AAGGTAATTTTAATCAAAACATGCTATTATTTGG 2 181 1 TAATAAACAC 0.977365 -110 TGGAACGATTTATTATTATAAGGCGTTAGAGACG 2 212 1 TATTTTAAAC 0.834352 -79 AAATTAGGCTCTTTTTAAACAGCCAAAGCGTCTC 2 240 0 CTTTTAACAC 0.898045 -51 **** *** ** * Masking position 8 Map Score: 5.07416 Number of sites scoring better than the average of aligned sites = 518 Number in coding regions = 429 Number in noncoding regions = 89 Number of orfs with sites within 600 bp upstream = 71 Fraction of orfs with sites within 600 bp upstream = 0.0114038 Motif number 4 ********** No masking Map Score: -2.60469e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.60469e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.60469e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0