AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i265_hypothetical10_hpyl_reg_100.orf -o265_hpyl_100.ace -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -g0.39 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.39 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RHP01418 228 AE000511 Motif number 1 TCGCTCTTTAATTTTAATCATTGACAAGGAG 1 25 0 ATTTTAATCT 0.930697 -204 AAGAGCGATGTCCTTAATCGTCCAACTATTG 1 48 1 TCCTTAATCT 0.983076 -181 AATCTTAAGATCTTTAAAGATTTTAAAAACT 1 86 0 TCTTTAAAGT 0.942627 -143 GTGGGTTTTTTCTTAAATCTTAAGATCTTTA 1 101 0 TCTTAAATCT 0.973745 -128 GAAAAAACCCACTTTAAAAATACCTAAAAAA 1 120 1 ACTTTAAAAT 0.757306 -109 CTTTAAAAATACCTAAAAAATACAGAGCAAC 1 131 1 ACCTAAAAAT 0.961109 -98 TAATGAAATTTTCTTAAAATTATACAATATG 1 190 0 TTCTTAAAAT 0.916117 -39 AATTCCCCTTACTTAAATAATGAAATTTTCT 1 207 0 ACTTAAATAT 0.967901 -22 ********* * Masking position 6 Map Score: 9.10647 Number of sites scoring better than the average of aligned sites = 690 Number in coding regions = 538 Number in noncoding regions = 152 Number of orfs with sites within 600 bp upstream = 149 Fraction of orfs with sites within 600 bp upstream = 0.0239319 Motif number 2 TCTTAACTACCAAACTCCTTGTCAATGATT 1 11 1 CAAACTCCTT 0.952637 -218 CGATTAAGGACATCGCTCTTTAATTTTAAT 1 38 0 CATCGCTCTT 0.98013 -191 ATTTAAGAAAAAACCCACTTTAAAAATACC 1 114 1 AAACCCACTT 0.978696 -115 AAATACAGAGCAACGCCCTTAGATTATACT 1 148 1 CAACGCCCTT 0.99643 -81 TAATTCCCCTTACTTAAATAA 1 218 0 AATTCCCCTT 0.969873 -11 ********** Masking position 2 Map Score: 3.94562 Number of sites scoring better than the average of aligned sites = 580 Number in coding regions = 519 Number in noncoding regions = 61 Number of orfs with sites within 600 bp upstream = 51 Fraction of orfs with sites within 600 bp upstream = 0.00819146 Motif number 3 CTCCTTGTCAATGATTAAAATTAAAGAGCGAT 1 25 1 ATTTAAAATT 0.909231 -204 ATCTTTAAAGATTTTAAAAACTAATACAGCAA 1 76 0 ATTAAAAACT 0.957972 -153 TTTTTCTTAAATCTTAAGATCTTTAAAGATTT 1 94 0 ATTAAGATCT 0.972424 -135 TAACTTAACTATAGTATAATCTAAGGGCGTTG 1 158 0 ATTATAATCT 0.973906 -71 TAAGTTACATATTGTATAATTTTAAGAAAATT 1 183 1 ATTATAATTT 0.966789 -46 CCTTACTTAAATAATGAAATTTTCTTAAAATT 1 200 0 ATTGAAATTT 0.964976 -29 ** ******** Masking position 5 Map Score: 4.17043 Number of sites scoring better than the average of aligned sites = 165 Number in coding regions = 117 Number in noncoding regions = 48 Number of orfs with sites within 600 bp upstream = 38 Fraction of orfs with sites within 600 bp upstream = 0.00610344 Motif number 4 TCAATGATTAAAATTAAAGAGCGATGTCCT 1 32 1 AAATTAAAGA 0.925825 -197 AAGATTTAAGAAAAAACCCACTTTAAAAAT 1 111 1 AAAAAACCCA 0.930182 -118 ACCCACTTTAAAAATACCTAAAAAATACAG 1 126 1 AAAATACCTA 0.972108 -103 AAATACCTAAAAAATACAGAGCAACGCCCT 1 137 1 AAAATACAGA 0.98488 -92 TACTATAGTTAAGTTACATATTGTATAATT 1 174 1 AAGTTACATA 0.938935 -55 AATTTTCTTAAAATTATACAATATGTAACT 1 185 0 AAATTATACA 0.925825 -44 ********** Masking position 6 Map Score: 3.77667 Number of sites scoring better than the average of aligned sites = 164 Number in coding regions = 131 Number in noncoding regions = 33 Number of orfs with sites within 600 bp upstream = 28 Fraction of orfs with sites within 600 bp upstream = 0.00449727 Motif number 5 ********** No masking Map Score: 2.86649e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.86649e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 2.86649e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0