AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i270_hypothetical15_hpyl_reg_100.orf -o270_hpyl_100.ace -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -g0.39 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.39 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RHP01332 22 AE000511 #2 RHP01335 28 AE000511 #3 RHP01336 120 AE000511 Motif number 1 ATTCTCATGCTTTTAAAATCACTCT 2 6 0 TTTTAAAATC 0.991278 -23 TAAAGAAAATTTTCAAAATGTG 3 3 0 TTTCAAAATG 0.959918 -118 TGAAAATTTTCTTTAAAAAAACCGCTAATT 3 18 1 CTTTAAAAAA 0.927073 -103 TTACAAAATCGTTTAAAAACTAACAATTAG 3 42 0 GTTTAAAAAC 0.919717 -79 CTTTTTTGGCTTACAAAATCGTTTAAAAAC 3 52 0 TTACAAAATC 0.984816 -69 TATAAAATAAATATAAAATCCTTAAGGGTA 3 89 0 ATATAAAATC 0.974452 -32 GACTGCCTTACTATAAAATAAATATAAAAT 3 100 0 CTATAAAATA 0.972297 -21 ********** Masking position 5 Map Score: 10.2965 Number of sites scoring better than the average of aligned sites = 1207 Number in coding regions = 1016 Number in noncoding regions = 191 Number of orfs with sites within 600 bp upstream = 142 Fraction of orfs with sites within 600 bp upstream = 0.0228076 Motif number 2 AATTCTTCTTTATGGCTATTC 1 12 0 ATTCTTCTTT 0.990686 -11 ACATTTTGAAAATTTTCTTTAAAAAAACCG 3 12 1 AATTTTCTTT 0.953329 -109 AAAACCGCTAATTGTTAGTTTTTAAACGAT 3 35 1 ATTGTTAGTT 0.943805 -86 AGGGTATTGTATCCTTTTTTGGCTTACAAA 3 65 0 ATCCTTTTTT 0.958143 -56 TAAGGATTTTATATTTATTTTATAGTAAGG 3 95 1 ATATTTATTT 0.945261 -26 ********** Masking position 5 Map Score: 2.14575 Number of sites scoring better than the average of aligned sites = 512 Number in coding regions = 439 Number in noncoding regions = 73 Number of orfs with sites within 600 bp upstream = 63 Fraction of orfs with sites within 600 bp upstream = 0.0101189 Motif number 3 AATTCTTCTTTATGGCTATTCT 1 3 0 TTAGGCTATT 0.99157 -20 AAACTAACAATTAGCGGTTTTTTTAAAGAAA 3 25 0 TTACGGTTTT 0.9953 -96 TGTTAGTTTTTAAACGATTTTGTAAGCCAAA 3 47 1 TAACGATTTT 0.967473 -74 TATAAAATCCTTAAGGGTATTGTATCCTTTT 3 77 0 TTAGGGTATT 0.995347 -44 *** ******* Masking position 8 Map Score: 2.99483 Number of sites scoring better than the average of aligned sites = 127 Number in coding regions = 111 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 4 ********** No masking Map Score: 6.63809e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 6.63809e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 6.63809e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0