AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i274_hypothetical19_hpyl_reg_100.orf -o274_hpyl_100.ace -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -g0.39 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.39 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RHP00723 124 AE000511 Motif number 1 TATTACTATGGTTTTATCGTGTTATTTTAT 1 22 1 GTTTTATCGT 0.970531 -103 TTTTATCTAAGTTTTGGCATGCGCCAAAAC 1 46 1 GTTTTGGCAT 0.992392 -79 AATTTTGCGTGTTTTGGCGCATGCCAAAAC 1 56 0 GTTTTGGCGC 0.99931 -69 TAAAATAAGCGTTTTGATGCCATTTTTGGA 1 99 1 GTTTTGATGC 0.989151 -26 TTTGATGCCATTTTTGGAGCGATC 1 111 1 TTTTTGGAGC 0.986675 -14 ********** Masking position 5 Map Score: 8.80633 Number of sites scoring better than the average of aligned sites = 295 Number in coding regions = 281 Number in noncoding regions = 14 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 2 CATAGTAATAAAGATAACCCC 1 2 0 AAGATAACCC 0.993784 -123 AAACTTAGATAAAATAACACGATAAAACCA 1 30 0 AAAATAACAC 0.985675 -95 CAAAACACGCAAAATTATCGCTTTTAAGAT 1 70 1 AAAATTATCG 0.975423 -55 CTTTTAAGATAAAATAAGCGTTTTGATGCC 1 90 1 AAAATAAGCG 0.993316 -35 ********** Masking position 5 Map Score: 3.78197 Number of sites scoring better than the average of aligned sites = 212 Number in coding regions = 182 Number in noncoding regions = 30 Number of orfs with sites within 600 bp upstream = 28 Fraction of orfs with sites within 600 bp upstream = 0.00449727 Motif number 3 GATAAAATAACACGATAAAACCATAGTAAT 1 23 0 CACGATAAAA 0.992595 -102 ATGCCAAAACTTAGATAAAATAACACGATA 1 36 0 TTAGATAAAA 0.983445 -89 TTATCGCTTTTAAGATAAAATAAGCGTTTT 1 84 1 TAAGATAAAA 0.994096 -41 ********** Masking position 5 Map Score: 3.68776 Number of sites scoring better than the average of aligned sites = 64 Number in coding regions = 43 Number in noncoding regions = 21 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 4 ********** No masking Map Score: -6.15168e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -6.15168e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -6.15168e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0