AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i295_mixed10_hpyl_reg_100.orf -o295_hpyl_100.ace -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -g0.39 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.39 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RHP01336 120 AE000511 Motif number 1 AAAGAAAATTTTCAAAATGTG 1 2 0 TTCAAAATGT 0.919436 -119 AAATTTTCTTTAAAAAAACCGCTAATTGTT 1 21 1 TAAAAAAACC 0.972048 -100 TACAAAATCGTTTAAAAACTAACAATTAGC 1 41 0 TTTAAAAACT 0.944337 -80 TTTTTTGGCTTACAAAATCGTTTAAAAACT 1 51 0 TACAAAATCG 0.989708 -70 CAAAAAAGGATACAATACCCTTAAGGATTT 1 74 1 TACAATACCC 0.960175 -47 ATAAAATAAATATAAAATCCTTAAGGGTAT 1 88 0 TATAAAATCC 0.993937 -33 ACTGCCTTACTATAAAATAAATATAAAATC 1 99 0 TATAAAATAA 0.864564 -22 ********** Masking position 5 Map Score: 6.71435 Number of sites scoring better than the average of aligned sites = 1607 Number in coding regions = 1405 Number in noncoding regions = 202 Number of orfs with sites within 600 bp upstream = 148 Fraction of orfs with sites within 600 bp upstream = 0.0237713 Motif number 2 ********** No masking Map Score: -7.57276e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 3 ********** No masking Map Score: -7.57276e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -7.57276e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0