AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i295_mixed10_hpyl_reg_300.orf -o295_hpyl_300.ace -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -g0.39 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.39 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RHP01336 120 AE000511 #2 RHP01340 80 AE000511 Motif number 1 TTTTTTAAAGAAAATTTTCAAAATGTG 1 5 0 AAAATCAAAA 0.963067 -116 TTGGCTTACAAAATCGTTTAAAAACTAACAATT 1 44 0 AAATTTAAAA 0.983922 -77 TTGTAAGCCAAAAAAGGATACAATACCCTTAAG 1 66 1 AAAAATACAA 0.982931 -55 GCCTTACTATAAAATAAATATAAAATCCTTAAG 1 93 0 AAAAATATAA 0.985614 -28 TTAATAAAAGAAAAACCTTAAAAGGGAGCAAAA 2 15 0 AAAATTAAAA 0.989917 -66 GCTATAATACAACTTTAATAAAAGAAAAACCTT 2 29 0 AACTATAAAA 0.963066 -52 TTTATTTTTAAAAAGCTATAATACAACTTTAAT 2 43 0 AAAAATAATA 0.965781 -38 AGCTTTTTAAAAATAAAATATAAGGATCGTTA 2 59 1 AAATATATAA 0.976879 -22 **** ****** Masking position 10 Map Score: 11.6546 Number of sites scoring better than the average of aligned sites = 712 Number in coding regions = 529 Number in noncoding regions = 183 Number of orfs with sites within 600 bp upstream = 160 Fraction of orfs with sites within 600 bp upstream = 0.0256987 Motif number 2 TTTTCTTTAAAAAAACCGCTAATTGTTAGT 1 24 1 AAAAACCGCT 0.959181 -97 TTTTGGCTTACAAAATCGTTTAAAAACTAA 1 49 0 CAAAATCGTT 0.98922 -72 AAAAAGGATACAATACCCTTAAGGATTTTA 1 76 1 CAATACCCTT 0.984372 -45 AAAATAAATATAAAATCCTTAAGGGTATTG 1 86 0 TAAAATCCTT 0.980023 -35 TTTAATAAAAGAAAAACCTTAAAAGGGAGC 2 19 0 GAAAAACCTT 0.976351 -62 ********** Masking position 5 Map Score: 3.8386 Number of sites scoring better than the average of aligned sites = 654 Number in coding regions = 574 Number in noncoding regions = 80 Number of orfs with sites within 600 bp upstream = 71 Fraction of orfs with sites within 600 bp upstream = 0.0114038 Motif number 3 CATTTTGAAAATTTTCTTTAAAAAAACCGCTA 1 13 1 ATTTTTTTAA 0.951126 -108 AACCGCTAATTGTTAGTTTTTAAACGATTTTG 1 37 1 TGTTATTTTA 0.926579 -84 AGGATTTTATATTTATTTTATAGTAAGGCAGT 1 97 1 ATTTATTTTA 0.989223 -24 TTTTTCTTTTATTAAAGTTGTATTATAGCTTT 2 33 1 ATTAAGTTTA 0.926001 -48 CGATCCTTATATTTTATTTTTAAAAAGCTATA 2 56 0 ATTTTTTTTA 0.984692 -25 ***** *** ** Masking position 8 Map Score: 1.07471 Number of sites scoring better than the average of aligned sites = 292 Number in coding regions = 213 Number in noncoding regions = 79 Number of orfs with sites within 600 bp upstream = 79 Fraction of orfs with sites within 600 bp upstream = 0.0126887 Motif number 4 ********** No masking Map Score: 1.65857e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.65857e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.65857e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0