AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i299_mixed14_hpyl_reg_300.orf -o299_hpyl_300.ace -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -g0.39 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.39 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RHP00146 68 AE000511 #2 RHP00147 207 AE000511 Motif number 1 ATGCAAAATGACTTAAAACTAGCCCCTTT 1 10 0 ACTTAAAACT 0.968854 -59 TGATTGTAATCCTTAAAACTCATTTAGGAG 1 47 0 CCTTAAAACT 0.975331 -22 TCTTAGTGGCGTTTAAGAATAAGTTAAGAT 2 15 0 GTTTAAGAAT 0.925774 -193 CACTAAGAGCGCTAAAAAATGGGGTTTTTA 2 37 1 GCTAAAAAAT 0.966333 -171 AAAAAATGGGGTTTTTAAATTTTCGCGCAA 2 50 1 GTTTTTAAAT 0.584093 -158 TTAAAACGACCTTTATAAATAAAAATTAAA 2 98 0 CTTTATAAAT 0.562185 -110 AAATTTTAGGGTTTAAAACGACCTTTATAA 2 110 0 GTTTAAAACG 0.945824 -98 AAACCCTAAAATTTTAAAATACCATTTTTG 2 126 1 ATTTTAAAAT 0.495144 -82 CAAACCAATCATTCAAAAATGGTATTTTAA 2 139 0 ATTCAAAAAT 0.673011 -69 CTCAAAATAAGCTAAAAACTACCAACACCA 2 171 0 GCTAAAAACT 0.968961 -37 ********** Masking position 3 Map Score: 11.2978 Number of sites scoring better than the average of aligned sites = 1440 Number in coding regions = 1204 Number in noncoding regions = 236 Number of orfs with sites within 600 bp upstream = 196 Fraction of orfs with sites within 600 bp upstream = 0.0314809 Motif number 2 CAAAATGACTTAAAACTAGCCCCTTT 1 7 0 TAAAACTAGC 0.972817 -62 TAACTTATTCTTAAACGCCACTAAGAGCGC 2 19 1 TTAAACGCCA 0.920521 -189 CGCGAAAATTTAAAAACCCCATTTTTTAGC 2 47 0 TAAAAACCCC 0.962473 -161 TTTTAGGGTTTAAAACGACCTTTATAAATA 2 107 0 TAAAACGACC 0.9941 -101 CCCTAAAATTTTAAAATACCATTTTTGAAT 2 129 1 TTAAAATACC 0.965832 -79 AAAATAAGCTAAAAACTACCAACACCATAC 2 168 0 AAAAACTACC 0.974687 -40 ********** Masking position 5 Map Score: 5.40115 Number of sites scoring better than the average of aligned sites = 883 Number in coding regions = 779 Number in noncoding regions = 104 Number of orfs with sites within 600 bp upstream = 79 Fraction of orfs with sites within 600 bp upstream = 0.0126887 Motif number 3 AGGAGTATTGTAATGCAAAATGACTTAAAACTA 1 19 0 TAATCAATGA 0.872927 -50 TGCATTACAATACTCCTAAATGAGTTTTAAGGA 1 35 1 TACTCTATGA 0.975448 -34 GTTAATCTTAACTTATTCTTAAACG 2 3 1 TAATTTATTA 0.953277 -205 TATCATCATTTAATTTTTATTTATAAAGGTCGT 2 90 1 TAATTTATTA 0.944114 -118 TTTAAAATACCATTTTTGAATGATTGGTTTGTA 2 138 1 CATTTTATGA 0.924875 -70 AGTTTTTAGCTTATTTTGAGTGAAAGGATTAAG 2 181 1 TTATTTATGA 0.962327 -27 **** ** * *** Masking position 9 Map Score: 1.51989 Number of sites scoring better than the average of aligned sites = 99 Number in coding regions = 74 Number in noncoding regions = 25 Number of orfs with sites within 600 bp upstream = 29 Fraction of orfs with sites within 600 bp upstream = 0.00465789 Motif number 4 AAAGGGGCTAGTTTTAAGTCATTTTGCA 1 9 1 TAGTTTTAAG 0.861239 -60 AATGAGTTTTAAGGATTACAATCAAT 1 53 1 AAGGATTACA 0.912259 -16 AAGAATAAGTTAAGATTAAC 2 1 0 TAAGATTAAC 0.918131 -207 TAGTGGCGTTTAAGAATAAGTTAAGATTAA 2 12 0 TAAGAATAAG 0.843443 -196 GCTTTGCGCGAAAATTTAAAAACCCCATTT 2 53 0 AAAATTTAAA 0.893752 -155 CTTTATAAATAAAAATTAAATGATGATACA 2 88 0 AAAAATTAAA 0.931007 -120 TTAAACCCTAAAATTTTAAAATACCATTTT 2 124 1 AAATTTTAAA 0.893752 -84 TTTTGAGTGAAAGGATTAAGCAAG 2 194 1 AAGGATTAAG 0.979284 -14 ********** Masking position 8 Map Score: 4.74785 Number of sites scoring better than the average of aligned sites = 1003 Number in coding regions = 739 Number in noncoding regions = 264 Number of orfs with sites within 600 bp upstream = 230 Fraction of orfs with sites within 600 bp upstream = 0.0369419 Motif number 5 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0