AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i318_mixed31_hpyl_reg_100.orf -o318_hpyl_100.ace -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -g0.39 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.39 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RHP00617 40 AE000511 #2 RHP00618 65 AE000511 Motif number 1 ATGGTGTATAATTAAAGAATTTCT 1 5 1 TGTATAATTA 0.946488 -36 TGCCTTTACCCTTTAAAGAAATTC 1 27 0 TTTACCCTTT 0.953246 -14 GTTTATCCTTAGTTTTTAAAA 2 2 1 TTTATCCTTA 0.984803 -64 ATCCTTAGTTTTTAAAATAAGGTTATGTTA 2 15 1 TTTAAAATAA 0.952535 -51 ATCAAATCATTGTAACATAACCTTATTTTA 2 27 0 TGTAACATAA 0.980315 -39 AACATTCCTATTTATCAAATCATTGTAACA 2 40 0 TTTATCAAAT 0.891687 -26 TCCTTAAACATTCCTATTTATCA 2 53 0 TTAAACATTC 0.900133 -13 ********** Masking position 4 Map Score: 6.10719 Number of sites scoring better than the average of aligned sites = 961 Number in coding regions = 763 Number in noncoding regions = 198 Number of orfs with sites within 600 bp upstream = 175 Fraction of orfs with sites within 600 bp upstream = 0.0281079 Motif number 2 TTTAAAGAAATTCTTTAATTATACACCAT 1 10 0 TTCTTTAATT 0.989179 -31 ATTAAAGAATTTCTTTAAAGGGTAAAGGCA 1 21 1 TTCTTTAAAG 0.989149 -20 TTATCCTTAGTTTTTAAAATAAGGTTATGT 2 13 1 TTTTTAAAAT 0.747196 -53 ********** Masking position 7 Map Score: 2.15726 Number of sites scoring better than the average of aligned sites = 288 Number in coding regions = 253 Number in noncoding regions = 35 Number of orfs with sites within 600 bp upstream = 24 Fraction of orfs with sites within 600 bp upstream = 0.0038548 Motif number 3 ********** No masking Map Score: -4.73059e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -4.73059e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -4.73059e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0