AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i190_ribonucleoside_diphos___mgen_reg_100.orf -o190_mgen_100.ace -a/home/amcguire/alignace/lib/ORF_mgen.txt -z/skink1/amcguire/genomes/mgen.fna -g0.32 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.32 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMG00426 270 Mycoplasma #2 RMG01505 45 Mycoplasma #3 RMG02531 69 Mycoplasma #4 RMG00446 18 Mycoplasma Motif number 1 ATAACTCCTTTTGTCTATTAATC 1 4 1 ACTCCTTTTG 0.943092 -267 GCTGATACTCTGTCCTATTGAGCTATGATG 1 79 0 TGTCCTATTG 0.973149 -192 TACAGGTTCGATTCCTGTTGGTGACGCCAT 1 125 1 ATTCCTGTTG 0.943092 -146 ACTGGTAGGCTTTTTTATTGTTTTGTAGTT 1 182 1 TTTTTTATTG 0.886804 -89 GTTGTAGTCATTTCATTTTGGACAAAAAGA 1 230 1 TTTCATTTTG 0.982126 -41 AGCATAAAAATTTCTTTTTGTCCAAAATGA 1 242 0 TTTCTTTTTG 0.987458 -29 TAAAACCGCTTTTTATTTTGTTTTTTTAAT 3 18 0 TTTTATTTTG 0.926297 -52 GAAATTGTCTTTTAGACAGGTTATA 3 55 0 TGTCTTTTAG 0.904713 -15 ********** Masking position 6 Map Score: 8.56049 Number of sites scoring better than the average of aligned sites = 231 Number in coding regions = 204 Number in noncoding regions = 27 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 2 GATTTAGATGTGATTAATAGACAAAAGGAGTTA 1 12 0 TGATATAGCA 0.754203 -259 CAAAGTTTTATAATTGATCAACTGTCATCATAG 1 54 1 TAATATCACT 0.804144 -217 ACCAGTTATTTAACTGATAGGCAAATAAAGTTA 1 155 0 TAATATAGCA 0.979452 -116 ATCAGTTAAATAACTGGTAGGCTTTTTTATTGT 1 170 1 TAATGTAGCT 0.988182 -101 GCTTTTTTATTGTTTTGTAGTTTATCAAGGGTT 1 190 1 TGTTGTAGTT 0.877282 -81 AGGGTTAATTTAAGTTGTAGTCATTTCATTTTG 1 217 1 TAATGTAGCA 0.984708 -54 TTAATTTAATTTATCGTTTAGAATTGCTA 2 7 1 TAATATCGTT 0.932074 -39 ATTGCTATCTTAAGCAATAGTTT 2 33 1 TAACATAGTT 0.867585 -13 GAAATTGTCTTTTAGACAGGTTATACAT 3 52 0 TGTTTTAGCA 0.606641 -18 *** * **** ** Masking position 8 Map Score: 4.83102 Number of sites scoring better than the average of aligned sites = 49 Number in coding regions = 41 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 3 CTTTGGCACTTTTAGATTTAGATGTGATTA 1 29 0 TTTAGATTTA 0.878357 -242 GTGCCAAAGTTTTATAATTGATCAACTGTC 1 50 1 TTTATAATTG 0.973963 -221 ACTGGTAGGCTTTTTTATTGTTTTGTAGTT 1 182 1 TTTTTTATTG 0.837371 -89 TTTTTATTGTTTTGTAGTTTATCAAGGGTT 1 193 1 TTTGTAGTTT 0.861136 -78 TAATTTATCGTTTAGAATTGCTATCTTAAG 2 17 1 TTTAGAATTG 0.954925 -29 TTATTTTGTTTTTTTAATAAACATT 3 6 0 TTTTTAATAA 0.762602 -64 ATAAAACCGCTTTTTATTTTGTTTTTTTAA 3 19 0 TTTTTATTTT 0.872354 -51 TATTTATAGTTATCCACT 4 3 1 TTTATAGTTA 0.951741 -16 ********** Masking position 3 Map Score: 3.34753 Number of sites scoring better than the average of aligned sites = 496 Number in coding regions = 404 Number in noncoding regions = 92 Number of orfs with sites within 600 bp upstream = 59 Fraction of orfs with sites within 600 bp upstream = 0.00947639 Motif number 4 ********** No masking Map Score: -1.32571e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.32571e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.32571e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0