AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i228_6_1_1_17_mgen_reg_100.orf -o228_mgen_100.ace -a/home/amcguire/alignace/lib/ORF_mgen.txt -z/skink1/amcguire/genomes/mgen.fna -g0.32 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.32 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMG05344 25 Mycoplasma #2 RMG04236 300 Mycoplasma Motif number 1 AATCACCTGATTAATTGTTTC 1 15 1 TTAATTGTTT 0.811032 -11 AAGAGTTTATCTTTTTCATTAACATCGCCT 2 46 0 CTTTTTCATT 0.738244 -255 ATGAAAAAGATAAACTCTTTTTAGCAAGAA 2 57 1 TAAACTCTTT 0.853304 -244 TAAAATACCTCTTTTTCTTGCTAAAAAGAG 2 71 0 CTTTTTCTTG 0.806954 -230 TTGGCTTCTCCATATGCTTTTAAAATACCT 2 91 0 CATATGCTTT 0.931611 -210 TAACCCTTTATAAATTCTTTTTTCAGCAAT 2 122 0 TAAATTCTTT 0.938104 -179 AAAGAAACTGCTAACCCTTTATAAATTCTT 2 133 0 CTAACCCTTT 0.81467 -168 AAAGGGTTAGCAGTTTCTTTTAATAATACT 2 143 1 CAGTTTCTTT 0.974734 -158 TTTAATAATACTGATTCTTTTAATGGTAGT 2 161 1 CTGATTCTTT 0.987302 -140 GGTTATTTTGCTGATGGTTTAATTAAAGAA 2 272 1 CTGATGGTTT 0.888482 -29 TGAGATAGTTTCTTTAATTAAACCA 2 286 0 TAGTTTCTTT 0.934098 -15 ********** Masking position 9 Map Score: 9.5642 Number of sites scoring better than the average of aligned sites = 710 Number in coding regions = 670 Number in noncoding regions = 40 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 2 AATGGTTTTGTTTTGGTTATCACCACT 2 8 0 TTTTGGTTAT 0.869279 -293 GAGAAGCCAATATTGCTGAAAAAAGAATTT 2 111 1 TATTGCTGAA 0.93646 -190 TTTCTTTTAATAATACTGATTCTTTTAATG 2 156 1 TAATACTGAT 0.903599 -145 ATACTGATTCTTTTAATGGTAGTGATATTA 2 168 1 TTTTAATGGT 0.793537 -133 ATGGTAGTGATATTAGTGATTCCATTACAA 2 183 1 TATTAGTGAT 0.98124 -118 ATTATGTGTCTATTTGTAATGGAATCACTA 2 196 0 TATTTGTAAT 0.825625 -105 CTCAAAACCTTATTTATGATGCTAGTGGTA 2 234 1 TATTTATGAT 0.941863 -67 TTCTAGGTTATTTTGCTGATGGTTTAATTA 2 267 1 TTTTGCTGAT 0.980865 -34 ********** Masking position 4 Map Score: 5.54572 Number of sites scoring better than the average of aligned sites = 447 Number in coding regions = 427 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 3 TTATAATCACCTGATTAATTG 1 2 1 TATAATCACC 0.931038 -24 TTGTTTTGGTTATCACCACT 2 1 0 TATCACCACT 0.942212 -300 ACCAAAACAAAACCATTCCCCGCAAAGGCG 2 21 1 AACCATTCCC 0.926502 -280 TCTTTTTCATTAACATCGCCTTTGCGGGGA 2 37 0 TAACATCGCC 0.937746 -264 GAATCACTAATATCACTACCATTAAAAGAA 2 175 0 TATCACTACC 0.983835 -126 CCTAGAAGGTTACCACTAGCATCATAAATA 2 244 0 TACCACTAGC 0.975835 -57 TCTTTAATTAAACCATCAGCAAAATAACCT 2 271 0 AACCATCAGC 0.967789 -30 ********** Masking position 5 Map Score: 4.27363 Number of sites scoring better than the average of aligned sites = 297 Number in coding regions = 281 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 4 ********** No masking Map Score: 6.91659e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 6.91659e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 6.91659e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0