AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i002_Purine_Nucleotides_Metabolism_mjan_reg_100.orf -o002_mjan_100.ace -a/home/amcguire/genomes/ORF_mjan.txt -z/home/amcguire/genomes/mjan.fna -g0.31 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.31 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMJ06880 91 M_jannaschii_chromosome Motif number 1 TATATATTTTCTTTAATATTACTTCTCATT 1 20 0 CTTTAATATT 0.97819 -72 TTTTCTAAACTTTATATATTTTCTTTAATA 1 32 0 TTTATATATT 0.988239 -60 ATCTATTAAATTTTTATATTTTCTAAACTT 1 50 0 TTTTTATATT 0.994379 -42 CACTAATTTCTTTATCTATTAAATTTTTAT 1 63 0 TTTATCTATT 0.990646 -29 ********** Masking position 7 Map Score: 7.63188 Number of sites scoring better than the average of aligned sites = 289 Number in coding regions = 164 Number in noncoding regions = 125 Number of orfs with sites within 600 bp upstream = 137 Fraction of orfs with sites within 600 bp upstream = 0.0220045 Motif number 2 AACTTTATATATTTTCTTTAATATTACTTC 1 25 0 ATTTTCTTTA 0.996378 -67 AAATTTTTATATTTTCTAAACTTTATATAT 1 43 0 ATTTTCTAAA 0.988792 -49 AATCACCACTAATTTCTTTATCTATTAAAT 1 69 0 AATTTCTTTA 0.993631 -23 ********** Masking position 1 Map Score: 4.79908 Number of sites scoring better than the average of aligned sites = 288 Number in coding regions = 249 Number in noncoding regions = 39 Number of orfs with sites within 600 bp upstream = 42 Fraction of orfs with sites within 600 bp upstream = 0.0067459 Motif number 3 ACTTTATATATTTTCTTTAATATTACTTCT 1 24 0 TTTTCTTTAA 0.971353 -68 TTATATTTTCTAAACTTTATATATTTTCTT 1 37 0 TAAACTTTAT 0.9302 -55 TAGAAAATATAAAAATTTAATAGATAAAGA 1 55 1 AAAAATTTAA 0.649867 -37 ATCACCACTAATTTCTTTATCTATTAAATT 1 68 0 ATTTCTTTAT 0.971353 -24 ********** Masking position 6 Map Score: 1.45641 Number of sites scoring better than the average of aligned sites = 1890 Number in coding regions = 1582 Number in noncoding regions = 308 Number of orfs with sites within 600 bp upstream = 282 Fraction of orfs with sites within 600 bp upstream = 0.0452939 Motif number 4 ********** No masking Map Score: 9.48026e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 9.48026e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 9.48026e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0