AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i022_Hydratase_mjan_reg_100.orf -o022_mjan_100.ace -a/home/amcguire/genomes/ORF_mjan.txt -z/home/amcguire/genomes/mjan.fna -g0.31 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.31 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMJ07934 108 M_jannaschii_chromosome #2 RMJ04314 50 M_jannaschii_chromosome Motif number 1 ACCAAAAAGGTCTAAATTTTTATGTAAGAG 1 17 1 TCTAAATTTT 0.931609 -92 TATAATTAGTTTTAAAATCTCTTACATAAA 1 35 0 TTTAAAATCT 0.984988 -74 CCATAATTTATTTATAATTAGTTTTAAAAT 1 47 0 TTTATAATTA 0.96138 -62 TATAGCTTACTCTATAATCAAAACCATAAT 1 70 0 TCTATAATCA 0.966834 -39 TAGAGTAAGCTATAAAATATCAGGAGGGAT 1 86 1 TATAAAATAT 0.967323 -23 AACATTAACTTTTAAAATTTATTG 2 5 0 TTTAAAATTT 0.983814 -46 AATCACCCTATATACAATAAATAAACATTA 2 28 0 TATACAATAA 0.91103 -23 ********** Masking position 6 Map Score: 8.45417 Number of sites scoring better than the average of aligned sites = 1742 Number in coding regions = 1317 Number in noncoding regions = 425 Number of orfs with sites within 600 bp upstream = 342 Fraction of orfs with sites within 600 bp upstream = 0.0549309 Motif number 2 AAGGTCTAAATTTTTATGTAAGAGATTTTA 1 23 1 TTTTTATGTA 0.980224 -86 TCAAAACCATAATTTATTTATAATTAGTTT 1 53 0 AATTTATTTA 0.971253 -56 TAAAAGTTAATGTTTATTTATTGTATATAG 2 21 1 TGTTTATTTA 0.988423 -30 ********** Masking position 6 Map Score: 0.784819 Number of sites scoring better than the average of aligned sites = 267 Number in coding regions = 178 Number in noncoding regions = 89 Number of orfs with sites within 600 bp upstream = 89 Fraction of orfs with sites within 600 bp upstream = 0.0142949 Motif number 3 ATCTCTTACATAAAAATTTAGACCTTTTTG 1 19 0 TAAAAATTTA 0.876024 -90 GTAAGAGATTTTAAAACTAATTATAAATAA 1 40 1 TTAAAACTAA 0.975834 -69 TTAAAACTAATTATAAATAAATTATGGTTT 1 50 1 TTATAAATAA 0.885688 -59 TCCTGATATTTTATAGCTTACTCTATAATC 1 81 0 TTATAGCTTA 0.96446 -28 CAATAAATTTTAAAAGTTAATGTTTATTT 2 10 1 TTAAAAGTTA 0.97797 -41 ********** Masking position 5 Map Score: 3.87358 Number of sites scoring better than the average of aligned sites = 510 Number in coding regions = 331 Number in noncoding regions = 179 Number of orfs with sites within 600 bp upstream = 181 Fraction of orfs with sites within 600 bp upstream = 0.0290716 Motif number 4 ********** No masking Map Score: -6.86222e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -6.86222e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -6.86222e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0