AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i096_Nitrogen_Transport_mjan_reg_100.orf -o096_mjan_100.ace -a/home/amcguire/genomes/ORF_mjan.txt -z/home/amcguire/genomes/mjan.fna -g0.31 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.31 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMJ02835 287 M_jannaschii_chromosome Motif number 1 ATTGATGTTTTCTTTTTTATGTGGGCAGCA 1 26 0 TCTTTTTTAT 0.919672 -262 GTAGGTAAGATAATTCCTATAAAAGTGTTT 1 77 0 TAATTCCTAT 0.955497 -211 CCTACTACCCATCTTCCTAATTCCCCTAAT 1 102 1 ATCTTCCTAA 0.788099 -186 GAAGGAAAATTCTTTCCTTAGTAAGTTATA 1 147 0 TCTTTCCTTA 0.946434 -141 GAAAGAATTTTCCTTCCTATTATTTAGGAA 1 161 1 TCCTTCCTAT 0.991384 -127 AAAAGATTCTTTATTCCTAAATAATAGGAA 1 174 0 TTATTCCTAA 0.966025 -114 TAAAGAATCTTTTTTCCTTTTAGATAAAAA 1 191 1 TTTTTCCTTT 0.929408 -97 TTGGTAGTAATCATTTTTATTTTTATCTAA 1 210 0 TCATTTTTAT 0.937137 -78 AATCTCAACCTCATTTTTATAATTTTACAA 1 268 0 TCATTTTTAT 0.937137 -20 ********** Masking position 5 Map Score: 10.0421 Number of sites scoring better than the average of aligned sites = 869 Number in coding regions = 785 Number in noncoding regions = 84 Number of orfs with sites within 600 bp upstream = 68 Fraction of orfs with sites within 600 bp upstream = 0.0109219 Motif number 2 ATATTAACGATGCTGCCCACATAAAAAAGAAA 1 16 1 TGCTGCCCAT 0.982681 -272 AAAACATCAATACCATCCATATGTTTCACCTC 1 45 1 TACCATCCAT 0.983014 -243 TTATCTTACCTACTACCCATCTTCCTAATTCC 1 94 1 TACTACCCAT 0.996435 -194 TAAAAATGATTACTACCAAATTCAAATTAATC 1 221 1 TACTACCAAT 0.992009 -67 TTAATCTAAAAACCACCAAATTTGTAAAATTA 1 247 1 AACCACCAAT 0.976041 -41 ********* * Masking position 9 Map Score: 3.85804 Number of sites scoring better than the average of aligned sites = 45 Number in coding regions = 38 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 3 ACATATGGATGGTATTGATGTTTTCTTTTT 1 39 0 GGTATTGATG 0.928983 -249 TCCTATAAAAGTGTTTGAGGTGAAACATAT 1 63 0 GTGTTTGAGG 0.978227 -225 TTAGGAAGATGGGTAGTAGGTAAGATAATT 1 92 0 GGGTAGTAGG 0.969164 -196 TTTCCATTAGGGGAATTAGGAAGATGGGTA 1 107 0 GGGAATTAGG 0.988494 -181 TTTCCTTCCTATTATTTAGGAATAAAGAAT 1 169 1 ATTATTTAGG 0.842058 -119 CAAATTTGGTGGTTTTTAGATTAATTTGAA 1 241 0 GGTTTTTAGA 0.9404 -47 ********** Masking position 8 Map Score: 1.8701 Number of sites scoring better than the average of aligned sites = 461 Number in coding regions = 418 Number in noncoding regions = 43 Number of orfs with sites within 600 bp upstream = 29 Fraction of orfs with sites within 600 bp upstream = 0.00465789 Motif number 4 GAAAAATATTAACGATGCTG 1 1 1 GAAAAATATT 0.956602 -287 TGGAAAAGCTTAAATATATAACTTACTAAG 1 131 1 TAAATATATA 0.852311 -157 TAATAGGAAGGAAAATTCTTTCCTTAGTAA 1 153 0 GAAAATTCTT 0.889452 -135 TCCTTTTAGATAAAAATAAAAATGATTACT 1 205 1 TAAAAATAAA 0.93358 -83 ACTACCAAATTCAAATTAATCTAAAAACCA 1 232 1 TCAAATTAAT 0.83936 -56 ACCAAATTTGTAAAATTATAAAAATGAGGT 1 261 1 TAAAATTATA 0.900076 -27 ********** Masking position 4 Map Score: 1.39976 Number of sites scoring better than the average of aligned sites = 1217 Number in coding regions = 842 Number in noncoding regions = 375 Number of orfs with sites within 600 bp upstream = 335 Fraction of orfs with sites within 600 bp upstream = 0.0538066 Motif number 5 ********** No masking Map Score: 2.93755e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.93755e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 2.93755e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0