AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i173_1_17_4_2_mjan_reg_100.orf -o173_mjan_100.ace -a/home/amcguire/genomes/ORF_mjan.txt -z/home/amcguire/genomes/mjan.fna -g0.31 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.31 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMJ00919 259 M_jannaschii_chromosome Motif number 1 AAATATAAATTAATCCTTATCAAT 1 3 1 ATATAAAAAT 0.918306 -257 CCTTATCAATATTTCAACATAATAAATCAATA 1 25 1 ATTTCAATAA 0.935218 -235 TCAACATAATAAATCAATATAAATTGCTCTTT 1 38 1 AAATCAATAA 0.905386 -222 CTCTTTAGTTAAATAAAGGGATTCTTCCATTT 1 64 1 AAATAAAGAT 0.97077 -196 TTAAAATAGTATATAAATGGAAGAATCCCTTT 1 78 0 ATATAAAGAA 0.986548 -182 TTTATATACTATTTTAAAAGATTATCGCACTT 1 93 1 ATTTTAAGAT 0.948103 -167 TATTTAAAATATTTAAGCGGAAATCCATTCCG 1 124 1 ATTTAAGGAA 0.912651 -136 CAGTAATAACATATAAACCTAACGGAATGGAT 1 146 0 ATATAAATAA 0.973911 -114 TTATTTGTAGATTTTAATGGATGACTTTATTA 1 207 0 ATTTTAAGAT 0.948281 -53 AAATAGTAAAAAATAAAATTATTTGTAGATTT 1 225 0 AAATAAATAT 0.944137 -35 ******* *** Masking position 6 Map Score: 11.9424 Number of sites scoring better than the average of aligned sites = 1117 Number in coding regions = 855 Number in noncoding regions = 262 Number of orfs with sites within 600 bp upstream = 223 Fraction of orfs with sites within 600 bp upstream = 0.0358175 Motif number 2 CAATATTTCAACATAATAAATCAATATAAA 1 31 1 ACATAATAAA 0.955901 -229 TAATCTTTTAAAATAGTATATAAATGGAAG 1 87 0 AAATAGTATA 0.957668 -173 CACTTATTTAAAATATTTAAGCGGAAATCC 1 120 1 AAATATTTAA 0.8924 -140 GTTATTACTGAAAAACTAAATACACATTCC 1 168 1 AAAAACTAAA 0.92477 -92 TTCCTAAGATAAGTAATAAAGTCATCCATT 1 194 1 AAGTAATAAA 0.955901 -66 ATCACCCAAAAAATAGTAAAAAATAAAATT 1 237 0 AAATAGTAAA 0.989212 -23 ********** Masking position 5 Map Score: 4.81482 Number of sites scoring better than the average of aligned sites = 519 Number in coding regions = 335 Number in noncoding regions = 184 Number of orfs with sites within 600 bp upstream = 175 Fraction of orfs with sites within 600 bp upstream = 0.0281079 Motif number 3 AAATATAAATTAATCCTTATCAATATTT 1 9 1 ATTAATCCTT 0.958813 -251 TTTCAACATAATAAATCAATATAAATTGCT 1 36 1 ATAAATCAAT 0.901223 -224 AAATAAAGGGATTCTTCCATTTATATACTA 1 74 1 ATTCTTCCAT 0.961861 -186 ATATTTAAGCGGAAATCCATTCCGTTAGGT 1 132 1 GGAAATCCAT 0.963336 -128 TAAGTAATAAAGTCATCCATTAAAATCTAC 1 203 1 AGTCATCCAT 0.9887 -57 ********** Masking position 6 Map Score: 2.4373 Number of sites scoring better than the average of aligned sites = 228 Number in coding regions = 200 Number in noncoding regions = 28 Number of orfs with sites within 600 bp upstream = 26 Fraction of orfs with sites within 600 bp upstream = 0.00417604 Motif number 4 ********** No masking Map Score: -3.81261e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -3.81261e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -3.81261e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0