AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i175_biotin_biosynthesis1_mjan_reg_100.orf -o175_mjan_100.ace -a/home/amcguire/genomes/ORF_mjan.txt -z/home/amcguire/genomes/mjan.fna -g0.31 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.31 maxlen = 30 weight = 0.8 exclude = 1 Purged sequences: RMJ04314 50 M_jannaschii_chromosome Input sequences: #1 RMJ13159 50 M_jannaschii_chromosome #2 RMJ01108 145 M_jannaschii_chromosome Motif number 1 TATACAATAAATAAACATTAACTTTTAAAA 1 24 1 ATAAACATTA 0.986911 -27 AACATTAACTTTTAAAATTTATTG 1 37 1 TTTAAAATTT 0.928982 -14 ATTTTATTTAATAAAAACTAAAAAAGAGAA 2 14 0 ATAAAAACTA 0.939598 -132 ATTAAATAAAATAAGCATTTATTTGGTTTC 2 32 1 ATAAGCATTT 0.957199 -114 AATTATTATAATTACAATTATCATTGATAT 2 64 0 ATTACAATTA 0.918257 -82 AATTGTAATTATAATAATTACGATTATCAT 2 75 1 ATAATAATTA 0.962221 -71 AATAATTACGATTATCATTTTGTGGTAAGT 2 87 1 ATTATCATTT 0.933183 -59 GGTAAGTTATTTAAACAGTAGATTAAAAAT 2 110 1 TTAAACAGTA 0.913086 -36 AAACAGTAGATTAAAAATTTTGATAGGTGA 2 122 1 TTAAAAATTT 0.961443 -24 ********** Masking position 4 Map Score: 11.9289 Number of sites scoring better than the average of aligned sites = 1294 Number in coding regions = 838 Number in noncoding regions = 456 Number of orfs with sites within 600 bp upstream = 393 Fraction of orfs with sites within 600 bp upstream = 0.0631224 Motif number 2 ACCCTATATACAATAAATAAACATTAACTT 1 18 1 CAATAAATAA 0.75285 -33 AATAAATAAACATTAACTTTTAAAATTTAT 1 29 1 CATTAACTTT 0.963399 -22 CAATAAATTTTAAAAGTTAA 1 41 0 CAATAAATTT 0.923239 -10 AGTTTTTATTAAATAAAATAAGCATTTATT 2 25 1 AAATAAAATA 0.91272 -121 TTATAATTACAATTATCATTGATATAGGAA 2 59 0 AATTATCATT 0.750977 -87 TGATAATTGTAATTATAATAATTACGATTA 2 71 1 AATTATAATA 0.654963 -75 TAATAATTACGATTATCATTTTGTGGTAAG 2 86 1 GATTATCATT 0.843141 -60 TCTACTGTTTAAATAACTTACCACAAAATG 2 102 0 AAATAACTTA 0.956301 -44 ********** Masking position 5 Map Score: 6.77131 Number of sites scoring better than the average of aligned sites = 2391 Number in coding regions = 1863 Number in noncoding regions = 528 Number of orfs with sites within 600 bp upstream = 417 Fraction of orfs with sites within 600 bp upstream = 0.0669772 Motif number 3 AAAAATCACCCTATATACAATAAATAAAC 1 10 1 CCTATATACA 0.968932 -41 TATTTGGTTTCCTATATCAATGATAATTGT 2 51 1 CCTATATCAA 0.988068 -95 GTTTAAATAACTTACCACAAAATGATAATC 2 96 0 CTTACCACAA 0.950988 -50 TTTATCACCTATCAAAATTTTTAATCT 2 129 0 CCTATCAAAA 0.98834 -17 ********** Masking position 4 Map Score: 1.34148 Number of sites scoring better than the average of aligned sites = 166 Number in coding regions = 140 Number in noncoding regions = 26 Number of orfs with sites within 600 bp upstream = 31 Fraction of orfs with sites within 600 bp upstream = 0.00497912 Motif number 4 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0