AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i229_sel_operon_mjan_reg_100.orf -o229_mjan_100.ace -a/home/amcguire/genomes/ORF_mjan.txt -z/home/amcguire/genomes/mjan.fna -g0.31 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.31 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMJ09342 119 M_jannaschii_chromosome #2 RMJ09012 34 M_jannaschii_chromosome Motif number 1 TTAAGTTTTTAATTTTTTAATTTAATAAAA 1 26 1 AATTTTTTAA 0.97518 -94 TATTATTTAAGTTTTATTAAATTAAAAAAT 1 37 0 GTTTTATTAA 0.940239 -83 CAAAAGTTTTTATTATTTAAGTTTTATTAA 1 47 0 TATTATTTAA 0.970637 -73 ATACTACACATATTTTTTAACAAAAGTTTT 1 67 0 TATTTTTTAA 0.993752 -53 TAGTGTGTTGTATTTAGAAATTTTTATACT 1 92 0 TATTTAGAAA 0.928962 -28 TACAACACACTATTTATTGA 1 110 1 TATTTATTGA 0.984561 -10 ATCACCAAATTATTTATTAATTAT 2 5 0 TATTTATTAA 0.995162 -30 ********** Masking position 10 Map Score: 13.0207 Number of sites scoring better than the average of aligned sites = 667 Number in coding regions = 516 Number in noncoding regions = 151 Number of orfs with sites within 600 bp upstream = 140 Fraction of orfs with sites within 600 bp upstream = 0.0224863 Motif number 2 GAATATCCCCCATTATTAAGTTTTTAATT 1 9 1 CCATTATTAA 0.968527 -111 TATTAAGTTTTTAATTTTTTAATTTAATAAA 1 24 1 TTATTTTTTA 0.919623 -96 AACAAAAGTTTTTATTATTTAAGTTTTATTA 1 48 0 TTATTATTTA 0.941641 -72 TTATACTACACATATTTTTTAACAAAAGTTT 1 68 0 CAATTTTTTA 0.9909 -52 CTAAATACAACACACTATTTATTGA 1 105 1 CAACTATTTA 0.986831 -15 TAGAAATCACCAAATTATTTATTAATTAT 2 9 0 CAATTATTTA 0.866211 -26 ** ******** Masking position 6 Map Score: 9.95388 Number of sites scoring better than the average of aligned sites = 280 Number in coding regions = 234 Number in noncoding regions = 46 Number of orfs with sites within 600 bp upstream = 51 Fraction of orfs with sites within 600 bp upstream = 0.00819146 Motif number 3 TTTTATTATTTAAGTTTTATTAAATTAAAA 1 40 0 TAAGTTTTAT 0.948885 -80 TTAACAAAAGTTTTTATTATTTAAGTTTTA 1 51 0 TTTTTATTAT 0.891761 -69 TTAAAAAATATGTGTAGTATAAAAATTTCT 1 77 1 TGTGTAGTAT 0.991305 -43 CAATAAATAGTGTGTTGTATTTAGAAATTT 1 99 0 TGTGTTGTAT 0.993921 -21 AATAATTTGGTGATTTCTATGGAA 2 21 1 TGATTTCTAT 0.964915 -14 ********** Masking position 5 Map Score: 3.87306 Number of sites scoring better than the average of aligned sites = 315 Number in coding regions = 272 Number in noncoding regions = 43 Number of orfs with sites within 600 bp upstream = 49 Fraction of orfs with sites within 600 bp upstream = 0.00787022 Motif number 4 ********** No masking Map Score: -1.53887e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.53887e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.53887e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0