AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i008_Uracil_Utilization_mpneu_reg_300.orf -o008_mpneu_300.ace -a/home/amcguire/alignace/lib/ORF_mpneu.txt -z/skink1/amcguire/genomes/mpneu.fna -g0.40 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.4 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMP00121 277 Mycoplasma_pneumoniae #2 RMP00122 123 Mycoplasma_pneumoniae Motif number 1 taaatagcaatcgtttatggcattaaagttgggt 1 14 1 tcgtttcatt 0.755279 -264 tatggcattaaagttgggtacactaccactagca 1 29 1 aagtggcact 0.97588 -249 aatctcacctaagtttagcaaacctttttttagg 1 90 1 aagttgaacc 0.985016 -188 aacctttttttaggtttgaacaccaaatcgggaa 1 110 1 tagttgcacc 0.985654 -168 gaaaacttaaatggttagttaactaggttcattt 1 164 0 atgttgaact 0.965428 -114 actatcttgatcgttttgaaaacttaaatggtta 1 181 0 tcgttgaact 0.984082 -97 tgctagttcaaagcttataaaactgaaaaggtaa 1 251 0 aagtttaact 0.963609 -27 ttttcgatcaaagcgtggtgcacttttttgatca 2 51 0 aaggtgcact 0.975881 -73 atttatcacgtagctttgtcaattcgttttcgat 2 77 0 tagttgaatt 0.955553 -47 *** ** * **** Masking position 12 Map Score: 8.23224 Number of sites scoring better than the average of aligned sites = 135 Number in coding regions = 117 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 2 ttcaaacctaaaaaaaggtttgctaaactt 1 100 0 aaaaaaggtt 0.795279 -178 tcgggaacttgaaaaaggtagtggttgaaa 1 137 1 gaaaaaggta 0.954392 -141 ttttcaaaacgatcaagatagtaaactaat 1 193 1 gatcaagata 0.912287 -85 gtaacagttagataaagctattaccttttc 1 231 1 gataaagcta 0.989251 -47 atgtgctagttcaaagcttataaaactga 1 259 0 ttcaaagctt 0.773766 -19 ataaggttatattaaagattga 2 3 0 attaaagatt 0.812711 -121 tttgatcacggttaaagatagtcttaataa 2 29 0 gttaaagata 0.958973 -95 aaaacgaattgacaaagctacgtgataaat 2 81 1 gacaaagcta 0.984109 -43 aaagctacgtgataaatcttcttcctcctc 2 94 1 gataaatctt 0.879851 -30 ********** Masking position 5 Map Score: 6.64671 Number of sites scoring better than the average of aligned sites = 490 Number in coding regions = 432 Number in noncoding regions = 58 Number of orfs with sites within 600 bp upstream = 48 Fraction of orfs with sites within 600 bp upstream = 0.0077096 Motif number 3 ttgggtacactaccactagcaacagaggaa 1 42 1 taccactagc 0.934447 -236 ggttcatttcaaccactacctttttcaagt 1 143 0 aaccactacc 0.993981 -135 caagatagtaaactaataccgtcgggtaac 1 206 1 aactaatacc 0.982482 -72 agctttatctaactgttacccgacggtatt 1 220 0 aactgttacc 0.978046 -58 agttagataaagctattaccttttcagttt 1 236 1 agctattacc 0.978045 -42 ********** Masking position 7 Map Score: 3.55055 Number of sites scoring better than the average of aligned sites = 98 Number in coding regions = 92 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 4 caataaatagcaatcgtttatgg 1 4 1 taaatagcaa 0.907691 -274 agcaacagaggaaatttaaacgagatcttg 1 59 1 gaaatttaaa 0.861123 -219 atttaaacgagatcttgcaatctcacctaa 1 72 1 gatcttgcaa 0.978715 -206 accaaatcgggaacttgaaaaaggtagtgg 1 131 1 gaacttgaaa 0.984372 -147 tataagctttgaactagcacat 1 266 1 gaactagcac 0.973101 -12 ccgaaattgcgaggaggaagaa 2 112 0 gaaattgcga 0.977463 -12 ********** Masking position 5 Map Score: 3.35598 Number of sites scoring better than the average of aligned sites = 159 Number in coding regions = 135 Number in noncoding regions = 24 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 5 caatctcacctaagtttagcaaacctttttt 1 89 1 taagtttaga 0.962005 -189 aaacctttttttaggtttgaacaccaaatcg 1 109 1 ttaggtttga 0.965169 -169 acttaaatggttagttaactaggttcatttc 1 163 0 ttagttaaca 0.901952 -115 tactatcttgatcgttttgaaaacttaaatg 1 185 0 atcgttttga 0.913696 -93 cccgacggtattagtttactatcttgatcgt 1 201 0 ttagtttaca 0.97793 -77 ttcagttttataagctttgaactagcacat 1 258 1 taagctttga 0.9234 -20 gctttgtcaattcgttttcgatcaaagcgtg 2 68 0 ttcgttttca 0.97489 -56 ********* * Masking position 11 Map Score: 3.63504 Number of sites scoring better than the average of aligned sites = 100 Number in coding regions = 72 Number in noncoding regions = 28 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 6 ********** No masking Map Score: -8.2833e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -8.2833e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -8.2833e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0