AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i009_Nucleotide_Biosynthes_mpneu_reg_300.orf -o009_mpneu_300.ace -a/home/amcguire/alignace/lib/ORF_mpneu.txt -z/skink1/amcguire/genomes/mpneu.fna -g0.40 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.4 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMP00517 300 Mycoplasma_pneumoniae Motif number 1 accaattctctatttgcgacttacgaaaaa 1 31 0 tatttgcgac 0.959927 -270 aactcgacgattttgccgaaaaatcacaga 1 78 1 ttttgccgaa 0.996889 -223 aatcacagaatattcgcgaatctttcggaa 1 99 1 tattcgcgaa 0.975976 -202 tttaccgtgtcttttccgaaagattcgcga 1 112 0 cttttccgaa 0.982627 -189 cattcgggggttttgccggacatcccgagt 1 161 0 ttttgccgga 0.988969 -140 ttgttacaattattggcgaacattcggggg 1 181 0 tattggcgaa 0.993056 -120 ttgtaacaaaattttccgaggtaatcgagt 1 224 1 attttccgag 0.910207 -77 aacgtcacaattttggcgaaatttcgaata 1 257 1 ttttggcgaa 0.996301 -44 tttcgaaatttttttccgcaaatt 1 287 1 tttttccgca 0.982628 -14 ********** Masking position 4 Map Score: 18.895 Number of sites scoring better than the average of aligned sites = 65 Number in coding regions = 62 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 2 acggtattctgttttttatgtttttcg 1 6 1 attctgtttt 0.98272 -295 ttatcaattaactcgacgattttgccgaaaaa 1 69 1 actcgaattt 0.961891 -232 attcgcgaatattctgtgatttttcggcaaaa 1 88 0 attctgattt 0.972565 -213 cgatccttttaccgtgtcttttccgaaagatt 1 117 0 accgtgtttt 0.789319 -184 aaaggatcgaactcggattttactcgggatgt 1 140 1 actcggttta 0.937333 -161 attggcgaacattcgggggttttgccggacat 1 168 0 attcgggttt 0.988971 -133 tgttacaattattggacaattttgttacaatt 1 200 0 attggaattt 0.94022 -101 tttcgccaaaattgtgacgtttttactcgatt 1 246 0 attgtggttt 0.944378 -55 atttcgaaatattcgaaatttcgccaaaattg 1 264 0 attcgatttc 0.930007 -37 atttcgaatatttcgaaatttttttccgcaaa 1 277 1 tttcgatttt 0.888914 -24 ****** **** Masking position 10 Map Score: 10.1446 Number of sites scoring better than the average of aligned sites = 164 Number in coding regions = 142 Number in noncoding regions = 22 Number of orfs with sites within 600 bp upstream = 18 Fraction of orfs with sites within 600 bp upstream = 0.0028911 Motif number 3 gcaaaatcgtcgagttaattgataagtttgg 1 63 0 cgagtaattg 0.920699 -238 tgtgatttttcggcaaaatcgtcgagttaat 1 75 0 cggcaaatcg 0.935346 -226 cgaaaaatcacagaatattcgcgaatctttc 1 94 1 cagatattcg 0.925443 -207 gtgtcttttccgaaagattcgcgaatattct 1 105 0 cgaagattcg 0.752009 -196 ggattttactcgggatgtccggcaaaacccc 1 154 1 cgggtgtccg 0.939954 -147 ggcaaaacccccgaatgttcgccaataattg 1 174 1 ccgatgttcg 0.957122 -127 caaaattttccgaggtaatcgagtaaaaacg 1 230 1 cgagtaatcg 0.985128 -71 aaaaaaatttcgaaatattcgaaatttcgcc 1 271 0 cgaatattcg 0.602411 -30 **** ****** Masking position 1 Map Score: 9.29871 Number of sites scoring better than the average of aligned sites = 78 Number in coding regions = 67 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 4 tttttcgtaagtcgcaaatagagaattggt 1 31 1 gtcgcaaata 0.9788 -270 ggacaattttgttacaattattggcgaaca 1 189 0 gttacaatta 0.992282 -112 ggaaaattttgttacaattattggacaatt 1 211 0 gttacaatta 0.992282 -90 gagtaaaaacgtcacaattttggcgaaatt 1 250 1 gtcacaattt 0.987455 -51 ********** Masking position 6 Map Score: 5.20436 Number of sites scoring better than the average of aligned sites = 4 Number in coding regions = 3 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 5 tttttcggcaaaatcgtcgagttaattgat 1 71 0 aaatcgtcga 0.965668 -230 gtcttttccgaaagattcgcgaatattctg 1 104 0 aaagattcgc 0.985181 -197 agacacggtaaaaggatcgaactcggattt 1 130 1 aaaggatcga 0.974161 -171 caaaacccccgaatgttcgccaataattgt 1 176 1 gaatgttcgc 0.977228 -125 aaaaatttcgaaatattcgaaatttcgcca 1 270 0 aaatattcga 0.982773 -31 ********** Masking position 7 Map Score: 3.39542 Number of sites scoring better than the average of aligned sites = 24 Number in coding regions = 21 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0