AlignACE version 2.2  July 7, 1998
/home/amcguire/bin/alignACE -i015_Glycolysis_2_mpneu_reg_300.orf -o015_mpneu_300.ace -a/home/amcguire/alignace/lib/ORF_mpneu.txt -z/skink1/amcguire/genomes/mpneu.fna -g0.40 -x5 -e 
Parameter values:
 expect =  	5
 ncols =   	10
 npass =   	1000
 maxnpass =	100
 nruns =   	1000
 maxnruns =	100
 repeat =  	15
 maxreps = 	3
 nread =   	500
 ncycles = 	1
 fragment =	1
 psfact =  	0.1
 gcback =  	0.4
 maxlen =  	30
 weight =  	0.8
 exclude = 	1

Input sequences:
#1	RMP00535	19	Mycoplasma_pneumoniae
#2	RMP00540	206	Mycoplasma_pneumoniae
#3	RMP00541	48	Mycoplasma_pneumoniae
#4	RMP00542	38	Mycoplasma_pneumoniae

Motif number 1

   ccaatatattaatcgcgtt          	1	8	1	atatcgcgtt	    0.995374	-12
aaatttgaaaaaatttcgattgagatttagta	2	35	0	aattcgattg	    0.889056	-172
tttgccgcttaaagatcgctttgggcaaattt	2	61	0	aagtcgcttt	     0.98499	-146
acgcgaacgcacttttcgctttctaacgcgtc	2	128	1	atttcgcttt	    0.986537	-79
aatgccgcaaagaagacgcgttagaaagcgaa	2	142	0	aaaacgcgtt	    0.983099	-65
   tcgctaaaaaattcgcgttcgcgcaatcc	3	30	0	aaatcgcgtt	    0.996436	-19
        gaactactcgaattaaaattttta	4	3	1	atatcgaatt	    0.936551	-36
          * ** *******

Masking position 1
Map Score:   8.16898

Number of sites scoring better than the average of aligned sites = 44
Number in coding regions = 37
Number in noncoding regions = 7
Number of orfs with sites within 600 bp upstream = 7
Fraction of orfs with sites within 600 bp upstream = 0.00112432


Motif number 2

 ccaatatattaatcgcgtt          	1	10	1	taatcgcgtt	    0.972941	-10
tgccgcttaaagatcgctttgggcaaattt	2	61	0	agatcgcttt	    0.955764	-146
gcgaaaagtgcgttcgcgtaaggaaaagct	2	117	0	cgttcgcgta	    0.972921	-90
gcgaacgcacttttcgctttctaacgcgtc	2	130	1	ttttcgcttt	    0.907193	-77
tgccgcaaagaagacgcgttagaaagcgaa	2	142	0	aagacgcgtt	     0.95305	-65
 tcgctaaaaaattcgcgttcgcgcaatcc	3	30	0	aattcgcgtt	    0.991832	-19
taaaaattttaattcgagtagttc      	4	5	0	aattcgagta	    0.891247	-34
          **********

Masking position 9
Map Score:   7.47453

Number of sites scoring better than the average of aligned sites = 102
Number in coding regions = 88
Number in noncoding regions = 14
Number of orfs with sites within 600 bp upstream = 12
Fraction of orfs with sites within 600 bp upstream = 0.0019274


Motif number 3

cggtttctaacttcaatttttgctactaaa	2	12	1	cttcaatttt	    0.944167	-195
aaaaatttcgattgagatttagtagcaaaa	2	29	0	attgagattt	    0.958708	-178
atcgaaattttttcaaatttgcccaaagcg	2	47	1	tttcaaattt	    0.974052	-160
cgcgcaatccattaaaatttaacaaccaa 	3	10	0	attaaaattt	    0.983954	-39
aactactcgaattaaaatttttacatttta	4	12	1	attaaaattt	    0.983954	-27
          **********

Masking position 5
Map Score:   3.89885

Number of sites scoring better than the average of aligned sites = 33
Number in coding regions = 17
Number in noncoding regions = 16
Number of orfs with sites within 600 bp upstream = 15
Fraction of orfs with sites within 600 bp upstream = 0.00240925


Motif number 4

          **********

No masking
Map Score:   -2.53363e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 5

          **********

No masking
Map Score:   -2.53363e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 6

          **********

No masking
Map Score:   -2.53363e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0