AlignACE version 2.2  July 7, 1998
/home/amcguire/bin/alignACE -i038_Galactose_Metabolism__mpneu_reg_100.orf -o038_mpneu_100.ace -a/home/amcguire/alignace/lib/ORF_mpneu.txt -z/skink1/amcguire/genomes/mpneu.fna -g0.40 -x5 -e 
Parameter values:
 expect =  	5
 ncols =   	10
 npass =   	1000
 maxnpass =	100
 nruns =   	1000
 maxnruns =	100
 repeat =  	15
 maxreps = 	3
 nread =   	500
 ncycles = 	1
 fragment =	1
 psfact =  	0.1
 gcback =  	0.4
 maxlen =  	30
 weight =  	0.8
 exclude = 	1

Input sequences:
#1	RMP00579	300	Mycoplasma_pneumoniae

Motif number 1

taacggcaccggacgtcaccccatcgcccag	1	82	1	ggagtcaccc	    0.892152	-219
taaccttttggttcgtcaaccatcgaacaaa	1	120	1	gttgtcaacc	    0.697708	-181
actttgttttgatggtcgaccgagatctttg	1	186	1	gatgtcgacc	    0.938001	-115
taaaaaacgtgtttttcgaccgcgttaagca	1	215	0	gttttcgacc	    0.967216	-86
tttttagaacgtttgtcaacttgtgtaaaat	1	240	1	gttgtcaact	    0.966559	-61
          *** *******

Masking position 6
Map Score:   5.96734

Number of sites scoring better than the average of aligned sites = 24
Number in coding regions = 23
Number in noncoding regions = 1
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 2

aaagtgcttgtgttattgcgctatgtcgtg	1	17	0	tgttattgcg	    0.972862	-284
atccaaattacgtttttgagttacaactat	1	53	1	cgtttttgag	     0.96495	-248
ctacgtaaccttttggttcgtcaaccatcg	1	115	1	ttttggttcg	    0.964098	-186
ttagtgtgtctttttgttcgatggttgacg	1	133	0	tttttgttcg	    0.961354	-168
gaacaaccgttgttagtgtgtctttttgtt	1	145	0	tgttagtgtg	    0.950537	-156
aatactgaaactttgttttgatggtcgacc	1	177	1	ctttgttttg	     0.92259	-124
tcgaaaaacacgttttttagaacgtttgtc	1	227	1	cgttttttag	    0.957981	-74
          **********

Masking position 4
Map Score:   4.92967

Number of sites scoring better than the average of aligned sites = 204
Number in coding regions = 182
Number in noncoding regions = 22
Number of orfs with sites within 600 bp upstream = 19
Fraction of orfs with sites within 600 bp upstream = 0.00305172


Motif number 3

tcaaaaacgtaatttggattgcggtaaagt	1	42	0	aatttggatt	    0.982738	-259
tggattctttaaagtgaattttacacaagt	1	258	0	aaagtgaatt	    0.945812	-43
aatttggaataaattggattctttaaagtg	1	272	0	aaattggatt	    0.991205	-29
 gaacaagagaatttggaataaattggatt	1	282	0	aatttggaat	    0.979057	-19
          **********

Masking position 5
Map Score:   4.35827

Number of sites scoring better than the average of aligned sites = 18
Number in coding regions = 17
Number in noncoding regions = 1
Number of orfs with sites within 600 bp upstream = 2
Fraction of orfs with sites within 600 bp upstream = 0.000321234


Motif number 4

tgcttgtgttattgcgctatgtcgtggcac	1	13	0	attgcgctat	    0.827083	-288
cgtaatttggattgcggtaaagtgcttgtg	1	35	0	attgcggtaa	    0.978546	-266
ttaagcaaagatctcggtcgaccatcaaaa	1	192	0	atctcggtcg	    0.987258	-109
atctttgcttaacgcggtcgaaaaacacgt	1	210	1	aacgcggtcg	    0.991857	-91
          **********

Masking position 8
Map Score:   0.33875

Number of sites scoring better than the average of aligned sites = 45
Number in coding regions = 40
Number in noncoding regions = 5
Number of orfs with sites within 600 bp upstream = 6
Fraction of orfs with sites within 600 bp upstream = 0.000963701


Motif number 5

          **********

No masking
Map Score:   7.91135e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 6

          **********

No masking
Map Score:   7.91135e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 7

          **********

No masking
Map Score:   7.91135e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0