AlignACE version 2.2  July 7, 1998
/home/amcguire/bin/alignACE -i038_Galactose_Metabolism__mpneu_reg_300.orf -o038_mpneu_300.ace -a/home/amcguire/alignace/lib/ORF_mpneu.txt -z/skink1/amcguire/genomes/mpneu.fna -g0.40 -x5 -e 
Parameter values:
 expect =  	5
 ncols =   	10
 npass =   	1000
 maxnpass =	100
 nruns =   	1000
 maxnruns =	100
 repeat =  	15
 maxreps = 	3
 nread =   	500
 ncycles = 	1
 fragment =	1
 psfact =  	0.1
 gcback =  	0.4
 maxlen =  	30
 weight =  	0.8
 exclude = 	1

Input sequences:
#1	RMP00579	300	Mycoplasma_pneumoniae

Motif number 1

ctgggcgatggggtgacgtccggtgccgtta	1	82	0	gggtgactcc	    0.899725	-219
tttgttcgatggttgacgaaccaaaaggtta	1	120	0	ggttgacaac	    0.717496	-181
caaagatctcggtcgaccatcaaaacaaagt	1	186	0	ggtcgacatc	    0.945209	-115
tgcttaacgcggtcgaaaaacacgtttttta	1	215	1	ggtcgaaaac	    0.969258	-86
attttacacaagttgacaaacgttctaaaaa	1	240	0	agttgacaac	    0.968482	-61
          ******* ***

Masking position 6
Map Score:   5.96734

Number of sites scoring better than the average of aligned sites = 24
Number in coding regions = 23
Number in noncoding regions = 1
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 2

aaagtgcttgtgttattgcgctatgtcgtg	1	17	0	tgttattgcg	     0.97075	-284
atccaaattacgtttttgagttacaactat	1	53	1	cgtttttgag	    0.962247	-248
ctacgtaaccttttggttcgtcaaccatcg	1	115	1	ttttggttcg	    0.961331	-186
ttagtgtgtctttttgttcgatggttgacg	1	133	0	tttttgttcg	    0.958384	-168
gaacaaccgttgttagtgtgtctttttgtt	1	145	0	tgttagtgtg	    0.946782	-156
aatactgaaactttgttttgatggtcgacc	1	177	1	ctttgttttg	    0.916899	-124
tcgaaaaacacgttttttagaacgtttgtc	1	227	1	cgttttttag	    0.954766	-74
          **********

Masking position 4
Map Score:   4.92967

Number of sites scoring better than the average of aligned sites = 204
Number in coding regions = 182
Number in noncoding regions = 22
Number of orfs with sites within 600 bp upstream = 19
Fraction of orfs with sites within 600 bp upstream = 0.00305172


Motif number 3

actttaccgcaatccaaattacgtttttga	1	42	1	aatccaaatt	    0.982735	-259
acttgtgtaaaattcactttaaagaatcca	1	258	1	aattcacttt	    0.945979	-43
cactttaaagaatccaatttattccaaatt	1	272	1	aatccaattt	     0.99123	-29
aatccaatttattccaaattctcttgttc 	1	282	1	attccaaatt	    0.979124	-19
          **********

Masking position 6
Map Score:   4.35827

Number of sites scoring better than the average of aligned sites = 18
Number in coding regions = 17
Number in noncoding regions = 1
Number of orfs with sites within 600 bp upstream = 2
Fraction of orfs with sites within 600 bp upstream = 0.000321234


Motif number 4

gtgccacgacatagcgcaataacacaagca	1	13	1	atagcgcaat	    0.824944	-288
cacaagcactttaccgcaatccaaattacg	1	35	1	ttaccgcaat	    0.979419	-266
ttttgatggtcgaccgagatctttgcttaa	1	192	1	cgaccgagat	    0.987819	-109
acgtgtttttcgaccgcgttaagcaaagat	1	210	0	cgaccgcgtt	    0.992217	-91
          **********

Masking position 3
Map Score:   0.33875

Number of sites scoring better than the average of aligned sites = 45
Number in coding regions = 40
Number in noncoding regions = 5
Number of orfs with sites within 600 bp upstream = 6
Fraction of orfs with sites within 600 bp upstream = 0.000963701


Motif number 5

          **********

No masking
Map Score:   7.91135e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 6

          **********

No masking
Map Score:   7.91135e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 7

          **********

No masking
Map Score:   7.91135e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0