AlignACE version 2.2  July 7, 1998
/home/amcguire/bin/alignACE -i055_Arginine_Metabolism_mpneu_reg_100.orf -o055_mpneu_100.ace -a/home/amcguire/alignace/lib/ORF_mpneu.txt -z/skink1/amcguire/genomes/mpneu.fna -g0.40 -x5 -e 
Parameter values:
 expect =  	5
 ncols =   	10
 npass =   	1000
 maxnpass =	100
 nruns =   	1000
 maxnruns =	100
 repeat =  	15
 maxreps = 	3
 nread =   	500
 ncycles = 	1
 fragment =	1
 psfact =  	0.1
 gcback =  	0.4
 maxlen =  	30
 weight =  	0.8
 exclude = 	1

Input sequences:
#1	RMP00283	53	Mycoplasma_pneumoniae
#2	RMP00531	247	Mycoplasma_pneumoniae

Motif number 1

gattaattttaaataattaacaattgctttaattg	1	21	0	aaataaaatt	    0.791207	-33
taattatttaaaattaatcgaatttac        	1	37	1	aaattacatt	    0.858666	-17
ctggaaaattcaattaaccgtatttaaacatattc	2	25	0	caattacatt	    0.962296	-223
ccagcatcggaactgagacgaaatttgaaatgatg	2	56	1	aactgacatt	     0.84997	-192
acgaaatttgaaatgatgacgagtttaattgataa	2	73	1	aaatgaaatt	    0.924653	-175
gttgaaccataaatgacgcaaaatttagttaccgc	2	118	0	aaatgacatt	    0.987745	-130
tcttgtaacaaaatgacaaggtttttctaagatgg	2	181	1	aaatgaattt	    0.964343	-67
          ******  *  * **

Masking position 6
Map Score:   8.1156

Number of sites scoring better than the average of aligned sites = 48
Number in coding regions = 34
Number in noncoding regions = 14
Number of orfs with sites within 600 bp upstream = 15
Fraction of orfs with sites within 600 bp upstream = 0.00240925


Motif number 2

gttccgatgctggaaaattcaattaaccgta	2	38	0	tggaaaatca	    0.976435	-210
cgagtttaattgataaattaactggagcggt	2	92	1	tgataaataa	    0.863427	-156
ttaactggagcggtaactaaattttgcgtca	2	109	1	cggtaactaa	    0.994065	-139
atgggcaacacggaaacttcaccgacggaaa	2	218	1	cggaaactca	    0.995895	-30
acttcaccgacggaaactgaaccca      	2	233	1	cggaaactaa	    0.995849	-15
          ******** **

Masking position 6
Map Score:   5.25759

Number of sites scoring better than the average of aligned sites = 32
Number in coding regions = 31
Number in noncoding regions = 1
Number of orfs with sites within 600 bp upstream = 1
Fraction of orfs with sites within 600 bp upstream = 0.000160617


Motif number 3

    ggaagtaacgcaattaaagcaattgt	1	7	1	aacgcaatta	    0.946507	-47
tttaaaattaatcgaatttac         	1	43	1	atcgaattta	    0.971242	-11
aattcaattaaccgtatttaaacatattca	2	24	0	accgtattta	    0.875049	-224
aatacggttaattgaattttccagcatcgg	2	36	1	attgaatttt	    0.770868	-212
tcggaactgagacgaaatttgaaatgatga	2	62	1	gacgaaattt	    0.961551	-186
ttgaaatgatgacgagtttaattgataaat	2	80	1	gacgagttta	    0.928812	-168
ctggagcggtaactaaattttgcgtcattt	2	113	1	aactaaattt	    0.828137	-135
          **********

Masking position 8
Map Score:   1.96056

Number of sites scoring better than the average of aligned sites = 245
Number in coding regions = 220
Number in noncoding regions = 25
Number of orfs with sites within 600 bp upstream = 19
Fraction of orfs with sites within 600 bp upstream = 0.00305172


Motif number 4

          **********

No masking
Map Score:   -4.80737e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 5

          **********

No masking
Map Score:   -4.80737e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 6

          **********

No masking
Map Score:   -4.80737e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0