AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i055_Arginine_Metabolism_mpneu_reg_300.orf -o055_mpneu_300.ace -a/home/amcguire/alignace/lib/ORF_mpneu.txt -z/skink1/amcguire/genomes/mpneu.fna -g0.40 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.4 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMP00283 53 Mycoplasma_pneumoniae #2 RMP00531 247 Mycoplasma_pneumoniae #3 RMP00533 300 Mycoplasma_pneumoniae Motif number 1 ggaagtaacgcaattaaagcaatt 1 5 1 gtaacgcaat 0.945369 -49 gaattttccagcatcggaactgagacgaaa 2 49 1 gcatcggaac 0.906696 -199 catcggaactgagacgaaatttgaaatgat 2 60 1 gagacgaaat 0.971213 -188 aactggagcggtaactaaattttgcgtcat 2 111 1 gtaactaaat 0.886548 -137 gccccttcttgtaacaaaatgacaaggttt 2 175 1 gtaacaaaat 0.815889 -73 ttcaccgacggaaactgaaccca 2 235 1 gaaactgaac 0.837425 -13 aagaagtctggcaacgagatggctgactcg 3 48 0 gcaacgagat 0.856511 -253 tgaaagaatggaatggaaattttgattccc 3 119 1 gaatggaaat 0.858264 -182 ttattttttggaatgggaatcaaaatttcc 3 133 0 gaatgggaat 0.906471 -168 tgtcgacaacatgacggaatttatttccac 3 169 0 atgacggaat 0.851838 -132 tagttcaagtgaaacggaaaaaaagaaccc 3 225 1 gaaacggaaa 0.931469 -76 tccgattcgaatgacgaaattaacaatgtg 3 268 0 atgacgaaat 0.782151 -33 ttcgtcattcgaatcggaataatgtacatt 3 280 1 gaatcggaat 0.980205 -21 ********** Masking position 9 Map Score: 11.9582 Number of sites scoring better than the average of aligned sites = 209 Number in coding regions = 179 Number in noncoding regions = 30 Number of orfs with sites within 600 bp upstream = 22 Fraction of orfs with sites within 600 bp upstream = 0.00353357 Motif number 2 acggttaattgaattttccagcatcggaactgagacg 2 39 1 gattgcacgg 0.964242 -209 gtttaattgataaattaactggagcggtaactaaatt 2 95 1 tattggacgg 0.979432 -153 accttgtcattttgttacaagaaggggcgattccctg 2 166 0 ttttgaaggg 0.989739 -82 gctctggtggtattttgaaagaatggaatggaaattt 3 104 1 tattgaagga 0.945136 -197 ccaccattcgttattttttggaatgggaatcaaaatt 3 136 0 ttttgaaggg 0.989739 -165 tcatgttgtcgacatttaatcaacgggttaagaaaaa 3 185 1 gattcaaggg 0.935496 -116 agaaaaacgttagttcaagtgaaacggaaaaaaagaa 3 215 1 tatcgaacgg 0.988709 -86 cattgttaatttcgtcattcgaatcggaataatgtac 3 270 1 tttcgaacgg 0.982015 -31 ** ** *** *** Masking position 13 Map Score: 5.25877 Number of sites scoring better than the average of aligned sites = 39 Number in coding regions = 36 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 3 ttgctttaattgcgttacttcc 1 3 0 tgcgttactt 0.890221 -51 aattaaactcgtcatcatttcaaatttcgt 2 73 0 gtcatcattt 0.910484 -175 aactaaattttgcgtcatttatggttcaac 2 123 1 tgcgtcattt 0.989755 -125 atttccaccattcgttattttttggaatgg 3 147 0 ttcgttattt 0.969502 -154 ggaaataaattccgtcatgttgtcgacatt 3 171 1 tccgtcatgt 0.9417 -130 ccgtcatgttgtcgacatttaatcaacggg 3 182 1 gtcgacattt 0.942128 -119 cattgttaatttcgtcattcgaatcggaat 3 270 1 ttcgtcattc 0.972868 -31 ********** Masking position 7 Map Score: 4.97928 Number of sites scoring better than the average of aligned sites = 46 Number in coding regions = 35 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 4 acgtgtaggtcttggcagggaatcgcccctt 2 151 1 cttggcggga 0.982629 -97 cattttgttacaagaaggggcgattccctgc 2 165 0 caagaagggc 0.958022 -83 caaggtttttctaagatgggcatgggcaaca 2 197 1 ctaagagggc 0.994283 -51 taagggcaaccttggcggtgccagaacatcg 3 19 1 cttggcgtgc 0.982629 -282 agccgtcaagctaagacgggctctggtggta 3 85 1 ctaagagggc 0.994283 -216 ****** **** Masking position 8 Map Score: 2.5082 Number of sites scoring better than the average of aligned sites = 12 Number in coding regions = 11 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 5 taattatttaaaattaatcgaatttac 1 37 1 aaattaatcg 0.953676 -17 ctggaaaattcaattaaccgtatttaaaca 2 30 0 caattaaccg 0.971705 -218 tttaattgataaattaactggagcggtaac 2 96 1 aaattaactg 0.961134 -152 gcaacacggaaacttcaccgacggaaactg 2 222 1 aacttcaccg 0.96271 -26 tcgaatgacgaaattaacaatgtgcaggtg 3 262 0 aaattaacaa 0.859813 -39 ********** Masking position 5 Map Score: 0.816931 Number of sites scoring better than the average of aligned sites = 128 Number in coding regions = 103 Number in noncoding regions = 25 Number of orfs with sites within 600 bp upstream = 23 Fraction of orfs with sites within 600 bp upstream = 0.00369419 Motif number 6 aattttccagcatcggaactgagacgaaat 2 50 1 catcggaact 0.941083 -198 gttaatttatcaattaaactcgtcatcatt 2 84 0 caattaaact 0.886533 -164 gcatgggcaacacggaaacttcaccgacgg 2 216 1 cacggaaact 0.990842 -32 aaacttcaccgacggaaactgaaccca 2 231 1 gacggaaact 0.968481 -17 ttttccgtttcacttgaactaacgtttttc 3 216 0 cacttgaact 0.971023 -85 ********** Masking position 7 Map Score: 0.737794 Number of sites scoring better than the average of aligned sites = 42 Number in coding regions = 38 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 7 ********** No masking Map Score: -1.26233e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -1.26233e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -1.26233e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0