AlignACE version 2.2  July 7, 1998
/home/amcguire/bin/alignACE -i094_Ribose_Transport_mpneu_reg_100.orf -o094_mpneu_100.ace -a/home/amcguire/alignace/lib/ORF_mpneu.txt -z/skink1/amcguire/genomes/mpneu.fna -g0.40 -x5 -e 
Parameter values:
 expect =  	5
 ncols =   	10
 npass =   	1000
 maxnpass =	100
 nruns =   	1000
 maxnruns =	100
 repeat =  	15
 maxreps = 	3
 nread =   	500
 ncycles = 	1
 fragment =	1
 psfact =  	0.1
 gcback =  	0.4
 maxlen =  	30
 weight =  	0.8
 exclude = 	1

Input sequences:
#1	RMP00575	16	Mycoplasma_pneumoniae
#2	RMP00579	300	Mycoplasma_pneumoniae

Motif number 1

       ttaagggtcaaaaaag         	1	2	0	aggtcaaaaa	    0.979941	-15
tcgatggttgacgaaccaaaaggttacgtagt	2	114	0	acgacaaaag	    0.971441	-187
tggttcgtcaaccatcgaacaaaaagacacac	2	128	1	acctcaacaa	    0.988933	-173
gaacaaaaagacacactaacaacggttgttcc	2	144	1	acaacaacaa	    0.934446	-157
atctcggtcgaccatcaaaacaaagtttcagt	2	180	0	acctcaaaca	    0.976116	-121
tttgcttaacgcggtcgaaaaacacgtttttt	2	213	1	gcgtcaaaaa	    0.987371	-88
aagttgacaaacgttctaaaaaacgtgttttt	2	230	0	acgtcaaaaa	    0.996079	-71
          *** ** *****

Masking position 8
Map Score:   8.50015

Number of sites scoring better than the average of aligned sites = 61
Number in coding regions = 56
Number in noncoding regions = 5
Number of orfs with sites within 600 bp upstream = 5
Fraction of orfs with sites within 600 bp upstream = 0.000803084


Motif number 2

actttaccgcaatccaaattacgtttttga	2	42	1	aatccaaatt	    0.982707	-259
acttgtgtaaaattcactttaaagaatcca	2	258	1	aattcacttt	    0.947058	-43
cactttaaagaatccaatttattccaaatt	2	272	1	aatccaattt	    0.991396	-29
aatccaatttattccaaattctcttgttc 	2	282	1	attccaaatt	    0.979554	-19
          **********

Masking position 6
Map Score:   4.26036

Number of sites scoring better than the average of aligned sites = 18
Number in coding regions = 17
Number in noncoding regions = 1
Number of orfs with sites within 600 bp upstream = 2
Fraction of orfs with sites within 600 bp upstream = 0.000321234


Motif number 3

cgcaatccaaattacgtttttgagttacaac	2	49	1	atacgttttt	    0.982912	-252
agacacactaacaacggttgttccgaatact	2	152	1	aaacggttgt	    0.546442	-149
gcggtcgaaaaacacgttttttagaacgttt	2	223	1	acacgttttt	    0.980031	-78
cacgttttttagaacgtttgtcaacttgtgt	2	235	1	aaacgtttgt	    0.977106	-66
          * *********

Masking position 4
Map Score:   3.29666

Number of sites scoring better than the average of aligned sites = 19
Number in coding regions = 13
Number in noncoding regions = 6
Number of orfs with sites within 600 bp upstream = 5
Fraction of orfs with sites within 600 bp upstream = 0.000803084


Motif number 4

ataacggcaccggacgtcaccccatcgccc	2	81	1	cggacgtcac	      0.9505	-220
gtaaccttttggttcgtcaaccatcgaaca	2	119	1	ggttcgtcaa	    0.960938	-182
acactaacaacggttgttccgaatactgaa	2	156	1	cggttgttcc	    0.945127	-145
gcaaagatctcggtcgaccatcaaaacaaa	2	188	0	cggtcgacca	    0.756121	-113
ttgcttaacgcggtcgaaaaacacgttttt	2	214	1	cggtcgaaaa	    0.971269	-87
ttttttagaacgtttgtcaacttgtgtaaa	2	239	1	cgtttgtcaa	    0.978241	-62
          **********

Masking position 6
Map Score:   5.4301

Number of sites scoring better than the average of aligned sites = 46
Number in coding regions = 37
Number in noncoding regions = 9
Number of orfs with sites within 600 bp upstream = 7
Fraction of orfs with sites within 600 bp upstream = 0.00112432


Motif number 5

tgccacgacatagcgcaataacacaagcac	2	14	1	tagcgcaata	    0.939184	-287
acaagcactttaccgcaatccaaattacgt	2	36	1	taccgcaatc	    0.944464	-265
tttgatggtcgaccgagatctttgcttaac	2	193	1	gaccgagatc	    0.917487	-108
cgtgtttttcgaccgcgttaagcaaagatc	2	209	0	gaccgcgtta	     0.64179	-92
          **********

Masking position 2
Map Score:   1.68205

Number of sites scoring better than the average of aligned sites = 26
Number in coding regions = 24
Number in noncoding regions = 2
Number of orfs with sites within 600 bp upstream = 1
Fraction of orfs with sites within 600 bp upstream = 0.000160617


Motif number 6

          **********

No masking
Map Score:   2.51122e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 7

          **********

No masking
Map Score:   2.51122e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 8

          **********

No masking
Map Score:   2.51122e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0