AlignACE version 2.2  July 7, 1998
/home/amcguire/bin/alignACE -i094_Ribose_Transport_mpneu_reg_300.orf -o094_mpneu_300.ace -a/home/amcguire/alignace/lib/ORF_mpneu.txt -z/skink1/amcguire/genomes/mpneu.fna -g0.40 -x5 -e 
Parameter values:
 expect =  	5
 ncols =   	10
 npass =   	1000
 maxnpass =	100
 nruns =   	1000
 maxnruns =	100
 repeat =  	15
 maxreps = 	3
 nread =   	500
 ncycles = 	1
 fragment =	1
 psfact =  	0.1
 gcback =  	0.4
 maxlen =  	30
 weight =  	0.8
 exclude = 	1

Input sequences:
#1	RMP00575	16	Mycoplasma_pneumoniae
#2	RMP00579	300	Mycoplasma_pneumoniae

Motif number 1

       ttaagggtcaaaaaag         	1	2	0	aggtcaaaaa	    0.982888	-15
tcgatggttgacgaaccaaaaggttacgtagt	2	114	0	acgacaaaag	    0.975606	-187
tggttcgtcaaccatcgaacaaaaagacacac	2	128	1	acctcaacaa	    0.990571	-173
gaacaaaaagacacactaacaacggttgttcc	2	144	1	acaacaacaa	    0.943694	-157
atctcggtcgaccatcaaaacaaagtttcagt	2	180	0	acctcaaaca	    0.979613	-121
tttgcttaacgcggtcgaaaaacacgtttttt	2	213	1	gcgtcaaaaa	    0.989238	-88
aagttgacaaacgttctaaaaaacgtgttttt	2	230	0	acgtcaaaaa	    0.996663	-71
          *** ** *****

Masking position 8
Map Score:   8.50015

Number of sites scoring better than the average of aligned sites = 61
Number in coding regions = 56
Number in noncoding regions = 5
Number of orfs with sites within 600 bp upstream = 5
Fraction of orfs with sites within 600 bp upstream = 0.000803084


Motif number 2

actttaccgcaatccaaattacgtttttga	2	42	1	aatccaaatt	    0.982595	-259
acttgtgtaaaattcactttaaagaatcca	2	258	1	aattcacttt	    0.949727	-43
cactttaaagaatccaatttattccaaatt	2	272	1	aatccaattt	    0.991801	-29
aatccaatttattccaaattctcttgttc 	2	282	1	attccaaatt	    0.980615	-19
          **********

Masking position 6
Map Score:   4.26036

Number of sites scoring better than the average of aligned sites = 18
Number in coding regions = 17
Number in noncoding regions = 1
Number of orfs with sites within 600 bp upstream = 2
Fraction of orfs with sites within 600 bp upstream = 0.000321234


Motif number 3

cgcaatccaaattacgtttttgagttacaac	2	49	1	atacgttttt	    0.985107	-252
agacacactaacaacggttgttccgaatact	2	152	1	aaacggttgt	    0.539998	-149
gcggtcgaaaaacacgttttttagaacgttt	2	223	1	acacgttttt	    0.980006	-78
cacgttttttagaacgtttgtcaacttgtgt	2	235	1	aaacgtttgt	    0.974987	-66
          * *********

Masking position 4
Map Score:   3.29666

Number of sites scoring better than the average of aligned sites = 19
Number in coding regions = 13
Number in noncoding regions = 6
Number of orfs with sites within 600 bp upstream = 5
Fraction of orfs with sites within 600 bp upstream = 0.000803084


Motif number 4

gggcgatggggtgacgtccggtgccgttat	2	81	0	gtgacgtccg	    0.951479	-220
tgttcgatggttgacgaaccaaaaggttac	2	119	0	ttgacgaacc	    0.959861	-182
ttcagtattcggaacaaccgttgttagtgt	2	156	0	ggaacaaccg	    0.942838	-145
tttgttttgatggtcgaccgagatctttgc	2	188	1	tggtcgaccg	    0.761474	-113
aaaaacgtgtttttcgaccgcgttaagcaa	2	214	0	ttttcgaccg	    0.970398	-87
tttacacaagttgacaaacgttctaaaaaa	2	239	0	ttgacaaacg	    0.977269	-62
          **********

Masking position 5
Map Score:   5.4301

Number of sites scoring better than the average of aligned sites = 46
Number in coding regions = 37
Number in noncoding regions = 9
Number of orfs with sites within 600 bp upstream = 7
Fraction of orfs with sites within 600 bp upstream = 0.00112432


Motif number 5

gtgcttgtgttattgcgctatgtcgtggca	2	14	0	tattgcgcta	     0.93915	-287
acgtaatttggattgcggtaaagtgcttgt	2	36	0	gattgcggta	    0.943958	-265
gttaagcaaagatctcggtcgaccatcaaa	2	193	0	gatctcggtc	    0.916806	-108
gatctttgcttaacgcggtcgaaaaacacg	2	209	1	taacgcggtc	    0.640486	-92
          **********

Masking position 2
Map Score:   1.68205

Number of sites scoring better than the average of aligned sites = 26
Number in coding regions = 24
Number in noncoding regions = 2
Number of orfs with sites within 600 bp upstream = 1
Fraction of orfs with sites within 600 bp upstream = 0.000160617


Motif number 6

          **********

No masking
Map Score:   2.51122e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 7

          **********

No masking
Map Score:   2.51122e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 8

          **********

No masking
Map Score:   2.51122e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0