AlignACE version 2.2  July 7, 1998
/home/amcguire/bin/alignACE -i111_Amino_Acid_Transport_2_mpneu_reg_300.orf -o111_mpneu_300.ace -a/home/amcguire/alignace/lib/ORF_mpneu.txt -z/skink1/amcguire/genomes/mpneu.fna -g0.40 -x5 -e 
Parameter values:
 expect =  	5
 ncols =   	10
 npass =   	1000
 maxnpass =	100
 nruns =   	1000
 maxnruns =	100
 repeat =  	15
 maxreps = 	3
 nread =   	500
 ncycles = 	1
 fragment =	1
 psfact =  	0.1
 gcback =  	0.4
 maxlen =  	30
 weight =  	0.8
 exclude = 	1

Input sequences:
#1	RMP00155	300	Mycoplasma_pneumoniae
#2	RMP00158	67	Mycoplasma_pneumoniae

Motif number 1

       tagcataatactaaataaatact	1	4	1	cataatacta	     0.98286	-297
ataatactaaataaatactaataatattaa	1	15	1	ataaatacta	    0.966388	-286
ctactaatagcttaatattattagtattta	1	26	0	cttaatatta	    0.972653	-275
ataatattatcttaatattatttacctact	1	51	0	cttaatatta	    0.972653	-250
ttttctttaacataatattatcttaatatt	1	62	0	cataatatta	    0.936927	-239
gaaaaagtttctctatactatatagaagat	1	87	1	ctctatacta	    0.842997	-214
ccgtttactattaaatactaatcttctata	1	107	0	ttaaatacta	    0.925957	-194
ttccattttcctatataccactttcttttt	1	151	1	ctatatacca	    0.915544	-150
ttgggcacattttaataccacgttggtagc	1	186	1	tttaatacca	    0.960898	-115
ttggtagcatcttaataccctgatggtatt	1	208	1	cttaataccc	    0.951652	-93
taccgacgaaattaataccatcagggtatt	1	221	0	attaatacca	    0.982605	-80
ttcgtcggtaaataataccggaataatact	1	241	1	aataataccg	    0.788341	-60
ataataccggaataatactaaataaatatt	1	252	1	aataatacta	    0.962911	-49
ataatactaaataaatattagaatttaagc	1	263	1	ataaatatta	    0.881701	-38
          **********

Masking position 5
Map Score:   26.1625

Number of sites scoring better than the average of aligned sites = 166
Number in coding regions = 135
Number in noncoding regions = 31
Number of orfs with sites within 600 bp upstream = 15
Fraction of orfs with sites within 600 bp upstream = 0.00240925


Motif number 2

ttatcttaatattatttacctactaatagc	1	45	0	attatttacc	    0.972823	-256
agagaaactttttctttaacataatattat	1	71	0	tttctttaac	    0.972593	-230
ggaaaacaaatttgtttgccgtttactatt	1	125	0	tttgtttgcc	    0.970134	-176
ggcaaacaaatttgttttccattttcctat	1	135	1	tttgttttcc	    0.974777	-166
tatataccactttctttttcgcggttgggc	1	162	1	tttctttttc	    0.915161	-139
ttattccggtattatttaccgacgaaatta	1	237	0	attatttacc	    0.972823	-64
tccttttataattctttaagtgtttaattg	2	11	1	attctttaag	    0.839736	-57
          **********

Masking position 5
Map Score:   6.64019

Number of sites scoring better than the average of aligned sites = 206
Number in coding regions = 171
Number in noncoding regions = 35
Number of orfs with sites within 600 bp upstream = 23
Fraction of orfs with sites within 600 bp upstream = 0.00369419


Motif number 3

  tagcataatactaaataaatactaataa	1	9	1	tactaaataa	    0.984737	-292
agtttctctatactatatagaagattagta	1	92	1	tactatatag	    0.974277	-209
tgccgtttactattaaatactaatcttcta	1	109	0	tattaaatac	    0.950397	-192
ttttccattttcctatataccactttcttt	1	149	1	tcctatatac	    0.969141	-152
accggaataatactaaataaatattagaat	1	257	1	tactaaataa	    0.984737	-44
          **********

Masking position 5
Map Score:   5.39674

Number of sites scoring better than the average of aligned sites = 15
Number in coding regions = 8
Number in noncoding regions = 7
Number of orfs with sites within 600 bp upstream = 6
Fraction of orfs with sites within 600 bp upstream = 0.000963701


Motif number 4

attttaataccacgttggtagcatcttaat	1	194	1	cacgttggta	    0.993113	-107
atcttaataccctgatggtattaatttcgt	1	216	1	cctgatggta	    0.988174	-85
actggcctgtcccgttgttaaacctgacat	2	42	1	cccgttgtta	    0.993265	-26
          **********

Masking position 10
Map Score:   1.03422

Number of sites scoring better than the average of aligned sites = 8
Number in coding regions = 6
Number in noncoding regions = 2
Number of orfs with sites within 600 bp upstream = 2
Fraction of orfs with sites within 600 bp upstream = 0.000321234


Motif number 5

          **********

No masking
Map Score:   6.63809e-14

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 6

          **********

No masking
Map Score:   6.63809e-14

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 7

          **********

No masking
Map Score:   6.63809e-14

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0