AlignACE version 2.2  July 7, 1998
/home/amcguire/bin/alignACE -i136_Transmembrane_Transport_10_mpneu_reg_100.orf -o136_mpneu_100.ace -a/home/amcguire/alignace/lib/ORF_mpneu.txt -z/skink1/amcguire/genomes/mpneu.fna -g0.40 -x5 -e 
Parameter values:
 expect =  	5
 ncols =   	10
 npass =   	1000
 maxnpass =	100
 nruns =   	1000
 maxnruns =	100
 repeat =  	15
 maxreps = 	3
 nread =   	500
 ncycles = 	1
 fragment =	1
 psfact =  	0.1
 gcback =  	0.4
 maxlen =  	30
 weight =  	0.8
 exclude = 	1

Input sequences:
#1	RMP00137	300	Mycoplasma_pneumoniae

Motif number 1

gaaattaccacctctacttcccagagtttggg	1	54	1	cctctatccc	    0.996714	-247
aaacgtgagtcctccaactcccaaactctggg	1	73	0	cctccatccc	    0.998887	-228
gtggttattacccctacatcgagttgactatc	1	114	0	cccctatcga	    0.951426	-187
gtaataaccaccttcatttacctgaacttggt	1	135	1	ccttcatacc	    0.990336	-166
gactattcccactccagctaccaagttcaggt	1	154	0	actccatacc	    0.979133	-147
ctaaaacggaccttcatatcgagtcaaccaat	1	196	0	ccttcatcga	    0.981663	-105
          ******  ****

Masking position 6
Map Score:   7.24678

Number of sites scoring better than the average of aligned sites = 38
Number in coding regions = 35
Number in noncoding regions = 3
Number of orfs with sites within 600 bp upstream = 3
Fraction of orfs with sites within 600 bp upstream = 0.00048185


Motif number 2

gagttgactatctcgtggactaaacgtgag	1	96	0	tctcgtggac	    0.994374	-205
tacccctacatcgagttgactatctcgtgg	1	108	0	tcgagttgac	    0.994028	-193
gaccttcatatcgagtcaaccaatctcgtg	1	190	0	tcgagtcaac	    0.984149	-111
tattaatacttcgcttggacatgcttctaa	1	224	0	tcgcttggac	    0.994374	-77
          **********

Masking position 6
Map Score:   3.7103

Number of sites scoring better than the average of aligned sites = 9
Number in coding regions = 7
Number in noncoding regions = 2
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 3

         tttgcggattgaattagaatata	1	2	1	ttggattgaa	     0.99462	-299
atttctaggtttgcagattgatcagtatattc	1	27	0	ttggattgat	    0.986553	-274
ttctggcgaatttttgatcgaaaccgatttaa	1	257	0	tttgatcgaa	    0.986264	-44
       tttttgatgaacgaaattaatattc	1	286	0	ttggaacgaa	    0.990635	-15
          ***  *******

Masking position 7
Map Score:   2.25579

Number of sites scoring better than the average of aligned sites = 9
Number in coding regions = 8
Number in noncoding regions = 1
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 4

ctacttcccagagtttgggagttggaggact	1	67	1	gagttgggag	    0.993927	-234
tcaggtaaatgaaggtggttattacccctac	1	129	0	gaagtggtta	    0.963801	-172
tcatttacctgaacttggtagctggagtggg	1	148	1	gaattggtag	    0.994476	-153
gtccccacacgagattggttgactcgatatg	1	183	1	gagttggttg	    0.996428	-118
          *** *******

Masking position 6
Map Score:   2.19794

Number of sites scoring better than the average of aligned sites = 18
Number in coding regions = 12
Number in noncoding regions = 6
Number of orfs with sites within 600 bp upstream = 5
Fraction of orfs with sites within 600 bp upstream = 0.000803084


Motif number 5

gggaagtagaggtggtaatttctaggtttg	1	46	0	ggtggtaatt	    0.975199	-255
aactcgatgtaggggtaataaccaccttca	1	121	1	aggggtaata	    0.990036	-180
tggtagctggagtgggaatagtccccacac	1	163	1	agtgggaata	    0.990035	-138
gtccaagcgaagtattaatataattaaatc	1	234	1	agtattaata	    0.914751	-67
          **********

Masking position 7
Map Score:   1.0189

Number of sites scoring better than the average of aligned sites = 71
Number in coding regions = 66
Number in noncoding regions = 5
Number of orfs with sites within 600 bp upstream = 4
Fraction of orfs with sites within 600 bp upstream = 0.000642467


Motif number 6

          **********

No masking
Map Score:   7.91135e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 7

          **********

No masking
Map Score:   7.91135e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 8

          **********

No masking
Map Score:   7.91135e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0